Public Sessions
 

Sessions allow users to save snapshots of the Genome Browser and its current configuration, including displayed tracks, position, and custom track data. The Public Sessions tool allows users to easily share those sessions that they deem interesting with the rest of the world's researchers. You can add your own sessions to this list by checking the appropriate box on the Session Management page.

See the Sessions User's Guide for more information.

Sort by:

Screenshot Session Properties Creation Date Use Count
Description: yes
Author: aryanzandi123
Session Name: Core Chromatin State Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 50 		1733904000 50
Description: CTCF and SMC1 ChIP-seq data for Crewe et al submission to NAR
Author: Morgan.Crewe
Session Name: NAR_CTCF_SMC1_Data
Genome Assembly: mm10
Creation Date: 2024-12-10
Views: 58 		1733817600 58
Description: A new study in Nature reveals how the absence of a small gene segment due to alternative splicing in CPEB4 leads to the deregulation of 200 genes associated with autism spectrum disorders: https://www.nature.com/articles/s41586-024-08289-w An earlier work by the same authors identified this mRNA as a factor in the autism-like phenotype: https://www.nature.com/articles/s41586-018-0423-5 The work took place at IRB Barcelona: https://www.irbbarcelona.org/en/news/scientific/key-breakthrough-autism-pivotal-role-cpeb4-condensates-revealed: “Our results suggest that even small decreases in the percentage of microexon inclusion can have significant effects. This would explain why some individuals without a gene mutation develop idiopathic autism.” UCSC Genome Browser Session
Author: brianlee
Session Name: CPEB4_GCAAGGACATATGGGCGAAGGAGA
Genome Assembly: hg38
Creation Date: 2024-12-05
Views: 28 		1733385600 28
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2025_fig5
Genome Assembly: hg19
Creation Date: 2024-12-04
Views: 182 		1733299200 182
Description: 12
Author: aryanzandi123
Session Name: Core Chromatin State Window 2.0
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 14 		1733904000 14
Description: te
Author: aryanzandi123
Session Name: Alternate Repressors and Activators Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 14 		1733904000 14
Description: 15 stae ChromHMM model of MSC,PC,HC based on murine data and on a human ChromHMM model. (Neu et al. 2024)
Author: [email protected]
Session Name: murine and humanized ChromHMM model
Genome Assembly: mm39
Creation Date: 2024-11-15
Views: 533 		1731657600 533
Description: GFP+ ChIP-Seq data
Author: nimt0001
Session Name: GFP+ ChIP-Seq
Genome Assembly: danRer10
Creation Date: 2024-11-13
Views: 453 		1731484800 453
Description: Forebrain Enhancers Track Hub Description From cellular differentiation to organismal development, the spatiotemporal expression of tissue-specific genes is driven by regulatory DNA elements. Among these, enhancers—also referred to as distal-acting cis-regulatory modules (CRMs)—are essential for increasing gene expression. Enhancers are cis-acting DNA sequences that are functional irrespective of their orientation and exhibit variable distances from their target genes. Given the critical role of tissue-specific enhancers in development and disease, annotating the human genome with tissue- or cell-type-specific enhancers has garnered significant attention. However, this task presents several challenges: • Vast Search Space: Enhancers are dispersed throughout the 98.5% of the human genome that is non-protein-coding, creating a vast search space. • Variable Positioning: Enhancers can regulate target genes from upstream, downstream, or intronic locations, and may skip proximal genes to influence more distant ones. • Complex Gene Regulation: Some enhancers simultaneously regulate multiple genes, adding to the complexity of their annotation. • Lack of a Universal Sequence Code: Unlike protein-coding genes, enhancers lack a defined sequence code, making prediction highly nontrivial. Traditional enhancer prediction approaches, such as those based on evolutionary conservation or biochemical markers, face inherent limitations. Evolutionary methods often miss lineage-specific enhancers, while biochemical marks are not always definitive indicators of enhancer activity and can appear stochastically. To address these challenges, we recently developed and published (FEBS Letters, https://doi.org/10.1002/1873-3468.15030) a DNA-sequence-based enhancer prediction pipeline tailored to tissue-specific transcription factor (TF) occupancy patterns. This sequence-based model improves enhancer prediction accuracy by incorporating the following: 1. A curated set of tissue- or cell-type-relevant transcription factors. 2. Well-characterized binding motifs for the selected TFs. 3. A benchmark dataset of enhancers validated in vivo or in vitro for the relevant tissue or cell type. Using the mammalian forebrain as a model, we applied this approach to predict 25,000 distinct forebrain enhancers within the non-coding and non-repetitive regions of the human genome (hg19). Functional Evaluation of Predicted Forebrain Enhancers: Our predicted enhancer datasets were evaluated by intersecting predictions with the following: • Active brain enhancer-associated chromatin marks. • DNase hypersensitivity (HS) site data from brain cell lines. • GWAS-based brain-specific SNP data. Additionally, subsets of the predictions were experimentally validated through in vivo zebrafish transgenic models. Evolutionary analysis revealed that >85% of these enhancers are conserved only in mammals or primates, underscoring their lineage-specific functionality. Utility of This Track Hub: This track hub presents the genomic coordinates of these 25,000 predicted forebrain enhancers (CRMs) in the hg19 genome assembly. Researchers can visualize and analyze these enhancers in the UCSC Genome Browser alongside abundant genomic and epigenomic datasets. This hub enables the following: 1. Investigating Pathological and Developmental Mechanisms: Explore the genomic basis of brain-related diseases and developmental processes. 2. Examining Evolutionary Significance: Study the gene-regulatory foundations of mammalian and primate brain evolution. Access the track hub and begin exploring these predicted forebrain enhancers in the context of gene bodies and genomic regions of interest. While utilizing these data for your publications, please remember to cite our relevant paper: Shireen, H., Batool, F., Khatoon, H., Parveen, N., Sehar, N.U., Noor, U.S., Hussain, I., Ali, S., Abbasi, A. A. (2024). Predicting genome-wide tissue-specific enhancers via combinatorial transcription factor genomic occupancy analysis. FEBS Letters. https://doi.org/10.1002/1873-3468.15030
Author: abbasiam
Session Name: Predicted human forebrain enahncers_hg19
Genome Assembly: hg38
Creation Date: 2024-12-17
Views: 26 		1734422400 26
Description: ATAC-Seq from 8 sorted immune cell populations representing the early lymphoid hematopoietic differentiation cascade along the B cell lineage. Cell populations were isolated from healthy adult human bone marrow precursors and peripheral blood (n=13). A total of 78 samples are analyzed. Additional single-cell ATAC-Seq data from 5 healthy adult human bone marrow, recovering HSC, MPP, LMPP, CLP, cycling pro-B, pro-B, cycling pre-B, and pre-B cells, is analyzed.
Author: TransBioLab
Session Name: hg38_Brex
Genome Assembly: hg38
Creation Date: 2024-11-13
Views: 351 		1731484800 351
Description: MultiRegion chrX 1 156040895 chrY 1 57227415 https://www.jax.org/jax-mice-and-services/ipsc The KOLF2.1J cell line was derived from the HPSI0114i-kolf_2 line through extensive molecular and cellular characterization efforts, including the correction of a pathogenic mutation in ARID2. https://www.hipsci.org/#/lines/HPSI0114i-kolf_2 Biosample: SAMEA2547615 https://www.ebi.ac.uk/biosamples/samples/SAMEA2547615 subject id SAMEA2398402 https://www.ebi.ac.uk/biosamples/samples/SAMEA2398402 Originating cell line seems to have no chrY data. CRAM file /17998_8%235.cram track name=17998_8%235.cram bigDataUrl=http://ftp.sra.ebi.ac.uk/vol1/run/ERR120/ERR1203439/17998_8%235.cram type=bam Session: https://genome.ucsc.edu/s/brianlee/cram_KOLF2
Author: brianlee
Session Name: cram_KOLF2
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 111 		1731398400 111
Description: Module 08 Assignment
Author: LouisLiu
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 46 		1731398400 46
Description: RHO/H1FOO
Author: sofiaterenziani
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 33 		1730966400 33
Description: NRL/CPNE6
Author: sofiaterenziani
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38 		1730966400 38
Description: GUCA1B/GUCA1A
Author: sofiaterenziani
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 30 		1730966400 30
Description: PDE6C/RBP4
Author: sofiaterenziani
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34 		1730966400 34
Description: mm9_NRL_CPNE6
Author: l.g.altizer
Session Name: mm9_NRL_CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34 		1730966400 34
Description: mm9_CPNE6_NRL
Author: l.g.altizer
Session Name: mm9_CPNE6_NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 31 		1730966400 31
Description: 11/7
Author: aehodges
Session Name: mm9//Nrl gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 30 		1730966400 30
Description: mm9_RHO_H1FOO
Author: l.g.altizer
Session Name: mm9_RHO_H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 32 		1730966400 32
Description: 11/7
Author: aehodges
Session Name: mm9//Guac1B gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 22 		1730966400 22
Description: GUCA1B/GUCA1A
Author: madelinebarlas
Session Name: mm9 GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 36 		1730966400 36
Description: multiomics
Author: diazacex
Session Name: Multiomics_mm9_wt_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 30 		1730966400 30
Description: NRL/CPNE6
Author: madelinebarlas
Session Name: mm9 NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35 		1730966400 35
Description: PDE6C/RBP4
Author: madelinebarlas
Session Name: mm9 PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35 		1730966400 35
Description: Mouse Retina stuff
Author: ALLDEREP
Session Name: mm9MouseRetina
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37 		1730966400 37
Description: PDE6C/RBP4
Author: madisonflorenz
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 30 		1730966400 30
Description: NRL/CPNE6
Author: rchelsea
Session Name: mm9 NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 32 		1730966400 32
Description: RHO/H1FOO
Author: rchelsea
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34 		1730966400 34
Description: GUCA1B/GUCA1A
Author: madisonflorenz
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 29 		1730966400 29
Description: GUCA1B/GUCA1A
Author: rchelsea
Session Name: mm9 GUCA1B
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34 		1730966400 34
Description: 11/7
Author: aehodges
Session Name: mm9//PDE6C gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 20 		1730966400 20
Description: 11/7
Author: aehodges
Session Name: mm9//RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34 		1730966400 34
Description: PDE6C/RBP4
Author: rchelsea
Session Name: mm9 PDE6C
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35 		1730966400 35
Description: NRL/CPNE6
Author: madisonflorenz
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 32 		1730966400 32
Description: mm9 wt CBR Nrl-
Author: diazacex
Session Name: mm9_BAM_wt CBR_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 28 		1730966400 28
Description: RHO/H1FOO
Author: madisonflorenz
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38 		1730966400 38
Description: mm9_GUCA1B_GUCA1A
Author: l.g.altizer
Session Name: mm9_GUCA1B_GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 27 		1730966400 27
Description: GB Multiomics custom data tracks - 3
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 3
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35 		1730966400 35
Description: mm9_CBR_RNA_seq
Author: l.g.altizer
Session Name: mm9_CBR_RNA_seq
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 30 		1730966400 30
Description: wt CBRs Nrl- CBRs
Author: diazacex
Session Name: mm9_wt CBR_Nrl- CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35 		1730966400 35
Description: CBR regions with extra data
Author: ClaytonFannin
Session Name: mm9 CBR regions with extra data
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 31 		1730966400 31
Description: RHO/H1FOO
Author: madelinebarlas
Session Name: mm9 RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 31 		1730966400 31
Description: GB Multiomics custom data tracks - 2
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 2
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 43 		1730966400 43
Description: mm9_NRL/WT
Author: l.g.altizer
Session Name: mm9_NRL/WT
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 28 		1730966400 28
Description: mm9 CRX CBR mRNA
Author: madelinebarlas
Session Name: mm9 CRX CBR mRNA
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 28 		1730966400 28
Description: 11/7/24
Author: aehodges
Session Name: mm9//2nd
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37 		1730966400 37
Description: mm9 CBR regions
Author: ClaytonFannin
Session Name: mm9 CBR regions
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 32 		1730966400 32
Description: GB Multiomics custom data tracks - 1
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 1
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 29 		1730966400 29
Description: 11/7/24
Author: aehodges
Session Name: mm9//1st
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 22 		1730966400 22
Description: mm9 CRX CBR
Author: madelinebarlas
Session Name: mm9 CRX CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 32 		1730966400 32
Description: UCSC Genome browser features two custom tracks on chromosome 22, the regions from 20,100,000 to 20,140,000. The first track, titled as “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” traced with red ticks every 100 bases (by skip 100 bases), with a 100-base interval between each tick. The “even” track shows labels such as : “first,” “second,” and “third.” These tracks illustrates how BED format can be used to visualize specific genomic intervals with determined position.
Author: ankathi.s
Session Name: Module8 assignment
Genome Assembly: hg38
Creation Date: 2024-11-07
Views: 54 		1730966400 54
Description: This UCSC Genome Browser session features two custom tracks on chromosome 22, covering the region from 20,100,000 to 20,140,000. The first track, titled “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” uses red ticks every 100 bases, with a 100-base interval between each tick. The “even” track also includes labels for the first three ticks: “first,” “second,” and “third.” These tracks demonstrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.arushi
Session Name: Module_8_assignment_hg38
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 49 		1730880000 49
Description: This session features two custom tracks on chromosome 22 on hg38 assembly, covering the region from 20,100,000 to 20,140,000. The first track, labeled "spacer" marks blue ticks every 10,000 bases. The second track, called "even" displays red ticks at intervals of 100 bases, with a 100-base gap between each tick. Additionally, the "even" track includes labels for the first three ticks: "first," "second," and "third." These custom tracks illustrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.raj
Session Name: BINF 6310: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 40 		1730880000 40
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Pratham donda
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 41 		1730880000 41
Description: This is ganesan murugan's session
Author: ganesan.m
Session Name: ganesan_murugan
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 36 		1730880000 36
Description: PDE6B: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 37 		1730793600 37
Description: RNA-seq custom tracks activity - PDE6B
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 34 		1730793600 34
Description: RNA-seq custom tracks activity - PDE6A
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 32 		1730793600 32
Description: PDE6A: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 38 		1730793600 38
Description: GNAT2: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: GNAT2_rec_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 37 		1730793600 37
Description: GNAT 1: macula RNA-seq periperal retina RNA-seq
Author: diazacex
Session Name: GNAT1_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 38 		1730793600 38
Description: RNA-seq custom tracks activity - GNAT2
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT2
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 37 		1730793600 37
Description: RNA-seq custom tracks activity - GNAT1
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT1
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 48 		1730793600 48
Description: RHO macula RNA-seq RHO periperal retina RNA-seq
Author: diazacex
Session Name: RHO_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 38 		1730793600 38
Description: 11/5
Author: aehodges
Session Name: hg38//custom tracks
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 23 		1730793600 23
Description: RNA-seq custom tracks activity - RHO
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - RHO
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 50 		1730793600 50
Description: Rhodopsin
Author: ALLDEREP
Session Name: hg38RHOMacula
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 43 		1730793600 43
Description: This custom track displays genomic intervals from the provided test.bed file, showing regions of interest for our class assignment. The data spans chromosomes 1 and 7 and highlights segments related to gene regulation and expression.
Author: Shamitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 66 		1730793600 66
Description: This session contains custom tracks visualizing specific features on chromosome 22 between positions 20,100,000 and 20,140,000. It includes: Spacer Track: Description: Blue ticks placed every 10,000 bases. Color: Blue (RGB: 0, 0, 255) Key Positions: chr22:20100000-20100001 chr22:20110000-20110001 chr22:20120000-20120001 Even Track: Description: Red ticks placed every 100 bases, with skips of 100 bases between ticks. Color: Red (RGB: 255, 0, 0) Key Positions: chr22:20100000-20100100 (first) chr22:20100200-20100300 (second) chr22:20100400-20100500 (third)
Author: taliaroth19
Session Name: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-04
Views: 42 		1730707200 42
Description: customs tracks but better
Author: ALLDEREP
Session Name: hg38CustomTracksPractice - EA
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 45 		1730361600 45
Description: custom tracks
Author: ALLDEREP
Session Name: CustomTracks_Test
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 50 		1730361600 50
Description: CLIP2 is a gene that is related to linker protein function. Various RefSeq comparisons are aligned with expression levels from a variety of tissues.
Author: gwilds
Session Name: clip2
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 47 		1730361600 47
Description: MAPT mutations
Author: diazacex
Session Name: MAPT GB custom tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 49 		1730361600 49
Description: MAPT mutations looged by Clayton Fannin
Author: ClaytonFannin
Session Name: hg38 MAPT mutations Group 5 (CAF)
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 51 		1730361600 51
Description: 10/31 Intro to UCSC Custom Data tracks
Author: madisonflorenz
Session Name: 10/31 Intro to UCSC Custom Data tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 43 		1730361600 43
Description: 10/31/24
Author: aehodges
Session Name: hg38//MAPT gene
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 43 		1730361600 43
Description: UCSC GB custom tracks intro part 1A
Author: madisonflorenz
Session Name: UCSC GB custom tracks intro part 1A
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 48 		1730361600 48
Description: practicing custom tracks
Author: diazacex
Session Name: RHO Practice
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 42 		1730361600 42
Description: 10/31/24
Author: aehodges
Session Name: hg19//custom track
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 33 		1730361600 33
Description: ELK3 promoter region
Author: gauravagarwal
Session Name: ELK3_promoter
Genome Assembly: hg38
Creation Date: 2024-10-29
Views: 431 		1730188800 431
Description: epigenomic data generated for the training study
Author: weitzela
Session Name: 2024-10_training-study
Genome Assembly: rn7
Creation Date: 2024-10-25
Views: 182 		1729843200 182
Description: Looking at the mutations in distal and tumor tissue of liver (hepatocellular carcinoma) in Patient #8. The mutations found exclusively in tumor tissue biopsy are highlighted in blue windows.
Author: dlk_browse
Session Name: Patient8_ND6
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 900 		1728892800 900
Description: Ridley Ch 4 HTT Fig 1
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 1
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 207 		1728892800 207
Description: Ridley Ch 4 HTT Fig 2
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 2
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 188 		1728892800 188
Description: 10/13/24
Author: aehodges
Session Name: hg38/HTT Gene
Genome Assembly: hg38
Creation Date: 2024-10-13
Views: 48 		1728806400 48
Description: THP-1 monocyte PMA timecourse
Author: Firefoot97
Session Name: T2T_monocyte_PMA_timecourse
Genome Assembly: hub_3671779_hs1
Creation Date: 2024-10-10
Views: 62 		1728547200 62
Description: Tracks H3K9me3 during E5 gametocytogenesis
Author: sandracula
Session Name: Sci-Rep_H3K9me3_gametocytes
Genome Assembly: hub_4042823_pfa2
Creation Date: 2024-10-04
Views: 200 		1728028800 200
Description: For Art & Katja
Author: mc.sierant
Session Name: RNU4-2_cons
Genome Assembly: hg38
Creation Date: 2024-09-30
Views: 381 		1727683200 381
Description: Genes e Microssatélites do Salminus brasiliensis set/2024 - LARGE_UFSJ
Author: jguimasr
Session Name: LARGE_UFSJ-GCA_030463535.1
Genome Assembly: hub_4414904_GCA_030463535.1
Creation Date: 2024-08-05
Views: 115 		1722844800 115
Description: Exon 10
Author: sofiaterenziani
Session Name: Exon 10 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-26
Views: 64 		1727337600 64
Description: HDG_hg38
Author: l.g.altizer
Session Name: HDG_hg38
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 269 		1727164800 269
Description: HDG gene
Author: sofiaterenziani
Session Name: hg38 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 237 		1727164800 237
Description: 9/24/24
Author: aehodges
Session Name: hg38//HGD session 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 228 		1727164800 228
Description: HGD gene - Figure 2
Author: madisonflorenz
Session Name: HGD gene - Figure 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 69 		1727164800 69
Description: Human genome HGD gene
Author: rchelsea
Session Name: hg38 HGD #1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 45 		1727164800 45
Description: hg38HGDExon10
Author: ALLDEREP
Session Name: hg38HGDExon10
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 77 		1727164800 77
Description: HGD gene - Figure 1
Author: madisonflorenz
Session Name: HGD gene - Figure 1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 77 		1727164800 77
Description: hg38 HGD
Author: ALLDEREP
Session Name: hg38 HGD
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 69 		1727164800 69
Description: edwcdewd
Author: maddiebendele
Session Name: HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-23
Views: 65 		1727078400 65
Description: 9/20/24
Author: aehodges
Session Name: hg38//HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-20
Views: 53 		1726819200 53
Description: Human chr2 compared to other mammals
Author: sofiaterenziani
Session Name: hg38 - chr2 + other organisms
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 316 		1726560000 316
Description: Human and other primates
Author: rchelsea
Session Name: hg38 chr2 #2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 250 		1726560000 250
Description: 9/17/24
Author: aehodges
Session Name: hg38//session 2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 263 		1726560000 263
Description: Region of Human Chr2 in Ridley Chapter and Other Primates
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter and Other Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 67 		1726560000 67
Description: wow
Author: maddiebendele
Session Name: Fusion_Event_Bendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 66 		1726560000 66
Description: Synteny and Conservation among Primates and the human
Author: ALLDEREP
Session Name: Synteny and Conservation among Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 63 		1726560000 63
Description: Human and chimp chromosome #2
Author: rchelsea
Session Name: hg38 chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 71 		1726560000 71
Description: hg38 chromosome 2 comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 88 		1726560000 88
Description: region of human chromosome 2 discussed in the Ridley chapter
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 66 		1726560000 66
Description: Humans vs different Ape comparison of chr 3
Author: diazacex
Session Name: Comparison of Chr 3
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 64 		1726560000 64
Description: hg38 chromosome 2 full comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 full comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 75 		1726560000 75
Description: Human chromosome 2 in comparison to chimp chromosomes to show fusion.
Author: l.g.altizer
Session Name: Chimp_fusion
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 71 		1726560000 71
Description: Human fusion
Author: maddiebendele
Session Name: FusionEventBendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 60 		1726560000 60
Description: L1_ALS_trackDb
Author: UCSC_Rambo
Session Name: L1_ALS_trackDb
Genome Assembly: hg38
Creation Date: 2024-11-26
Views: 52 		1732608000 52
Description: for prez
Author: maddiebendele
Session Name: p.aergiona presentation
Genome Assembly: hub_3560215_GCF_000006765.1
Creation Date: 2024-09-17
Views: 91 		1726560000 91
Description: Ridley Ch2 Species Pt. 1
Author: madisonflorenz
Session Name: Ridley Ch2 Species Pt. 1
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 69 		1726560000 69
Description: Comparison on Chr2 with chimps
Author: sofiaterenziani
Session Name: hg38 - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 61 		1726560000 61
Description: human chr2 synteny to chimps
Author: marte2je
Session Name: hg38 chimp - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 57 		1726560000 57
Description: comparison of the KPNA6 gene from humans to opossums
Author: ALLDEREP
Session Name: M.Domestica Comparison
Genome Assembly: hg19
Creation Date: 2024-09-15
Views: 66 		1726387200 66
Description: H3K27ac ChIP-seq and RNA-seq of lung neuroendocrine tumors from GSE247574.
Author: yotamd
Session Name: lung_NET
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 403 		1725955200 403
Description: CRX gene isoforms
Author: madisonflorenz
Session Name: CRX gene isoforms
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 291 		1725955200 291
Description: CRX gene
Author: ClaytonFannin
Session Name: CRX gene BIO481 CAF
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 321 		1725955200 321
Description: 9/10
Author: aehodges
Session Name: CRX Gene
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 71 		1725955200 71
Description: The custom tracts represent Hop1 ChIP-Seq data in wild type, ATPase deficient mutant and null mutant. Bam files contains uniquely mapped reads to S. cerevisiae genome. The sample information is given below: 1. m_sorted_mapped_cer_HP1_4h_Ch_1.bam- Hop1 WT replicate 1, 2. m_sorted_mapped_cer_HP1_4h_Ch_2.bam- Hop1 WT replicate 2, 3. m_sorted_mapped_cer_HP1_4h_In_1.bam- Hop1 WT input, 4. m_sorted_mapped_cer_SK_Hp1m_4h_Ch1.bam- Hop1 ATPase mutant replicate 1, 5. m_sorted_mapped_cer_SK_Hp1m_4h_Ch2.bam- Hop1 ATPase mutant replicate 2, 6. m_sorted_mapped_cer_SK_Hp1m_4h_In2.bam- Hop1 ATPase mutant input, 7. m_sorted_mapped_cer_hp1_4h_Ch_1.bam- Hop1 null mutant repliacte 1, 8. m_sorted_mapped_cer_hp1_4h_Ch_2.bam- Hop1 null mutant replicate 2, 9. m_sorted_mapped_cer_hp1_4h_In_1.bam- Hop1 null mutant input
Author: Sameerjoshi1997
Session Name: Hop1 ChIP-Seq data
Genome Assembly: sacCer3
Creation Date: 2024-09-04
Views: 400 		1725436800 400
Description: Quiz 2
Author: sofiaterenziani
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 306 		1725350400 306
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO redo
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 296 		1725350400 296
Description: Quiz 1
Author: sofiaterenziani
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 79 		1725350400 79
Description: RHO
Author: diazacex
Session Name: RHO_hg19
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 84 		1725350400 84
Description: hg19 RHO
Author: madelinebarlas
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 86 		1725350400 86
Description: RHO gene and OMIM Alleles
Author: l.g.altizer
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 79 		1725350400 79
Description: RHO Gene & OMIM & Multi
Author: l.g.altizer
Session Name: hg19_RHO_2
Genome Assembly: hg38
Creation Date: 2024-09-03
Views: 83 		1725350400 83
Description: RHO
Author: ALLDEREP
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 93 		1725264000 93
Description: hg19 RHO - quiz #2
Author: madisonflorenz
Session Name: hg19 RHO - quiz #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 63 		1725264000 63
Description: hg19 RHO - Quiz 1
Author: gplaughon912
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 71 		1725264000 71
Description: hg19 RHO - Quiz 2
Author: gplaughon912
Session Name: hg19 RHO - Session 2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 83 		1725264000 83
Description: RHO NEW
Author: ALLDEREP
Session Name: hg19RHO NEW
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 69 		1725264000 69
Description: same as the previous rho but with highlight
Author: maddiebendele
Session Name: hg19 RHO2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 66 		1725264000 66
Description: Quiz 2
Author: aehodges
Session Name: hg19 RHO session 2
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 68 		1725177600 68
Description: hg19 RHO
Author: ClaytonFannin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 71 		1725177600 71
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-08-31
Views: 81 		1725091200 81
Description: Fall24 MouseBIO481 group5 (CAF)
Author: ClaytonFannin
Session Name: Fall24 MouseBIO481 group5 (CAF)
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 73 		1724918400 73
Description: Fall24 Worm BIO481 group#3
Author: madisonflorenz
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 54 		1724918400 54
Description: First experience using UCSC Genome Browser looking at the Rhodopsin gene of a mouse
Author: ALLDEREP
Session Name: Fall24 MouseBIO481 group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 89 		1724918400 89
Description: C.elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3 #2
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 45 		1724918400 45
Description: Fall24 MouseBIO481 group6
Author: madelinebarlas
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 90 		1724918400 90
Description: CGEMS Mouse AEH Test
Author: aehodges
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 97 		1724918400 97
Description: Fall24 Worm BIO481 group#3 C. elegans
Author: sofiaterenziani
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 76 		1724918400 76
Description: Fall24 Worm BIO481 group 3
Author: rchelsea
Session Name: Fall24 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 88 		1724918400 88
Description: MEK
Author: diazacex
Session Name: Fall24 Yeast BIO481 group#2
Genome Assembly: sacCer3
Creation Date: 2024-08-29
Views: 68 		1724918400 68
Description: In class assignment 8/29
Author: Mitcheij
Session Name: Fall24 Worm BIO481 group 4
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 83 		1724918400 83
Description: C. elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 70 		1724918400 70
Description: BIO481 UCSC Genome Browser Assignment - Group 5 Mouse
Author: gplaughon912
Session Name: Fall24 MouseBIO481 Group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 103 		1724918400 103
Description: Manuscript: Feedback Regulation of Retinaldehyde Reductase DHRS3, A Critical Determinant of Retinoic Acid Homeostasis Online resources: Potential RAR-bound regions, were identified using the ChIP-Seq tracks from the ReMap2022 Atlas on the GRCm38/mm10 mouse genome [1], accessed via the UCSC Genome Browser in April 2024 and filtered for RAR-ChIP sets. Potential RARE motifs were identified using TRANSFAC and JASPAR databases [2]. RAR ChIP-Seq tracks from ReMap and promoter and enhancer elements contained in ENCODE [3] are depicted in Fig. S4. 1. Hammal, F., de Langen, P., Bergon, A., Lopez, F. & Ballester, B. (2022) ReMap 2022: a database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments, Nucleic Acids Res. 50, D316-D325. 2. Rauluseviciute, I., Riudavets-Puig, R., Blanc-Mathieu, R., Castro-Mondragon, J. A., Ferenc, K., Kumar, V., Lemma, R. B., Lucas, J., Cheneby, J., Baranasic, D., Khan, A., Fornes, O., Gundersen, S., Johansen, M., Hovig, E., Lenhard, B., Sandelin, A., Wasserman, W. W., Parcy, F. & Mathelier, A. (2024) JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles, Nucleic Acids Res. 52, D174-D182. 3. Consortium, E. P., Moore, J. E., Purcaro, M. J., Pratt, H. E., Epstein, C. B., Shoresh, N., Adrian, J., Kawli, T., Davis, C. A., Dobin, A., Kaul, R., Halow, J., Van Nostrand, E. L., Freese, P., Gorkin, D. U., Shen, Y., He, Y., Mackiewicz, M., Pauli-Behn, F., Williams, B. A., Mortazavi, A., Keller, C. A., Zhang, X. O., Elhajjajy, S. I., Huey, J., Dickel, D. E., Snetkova, V., Wei, X., Wang, X., Rivera-Mulia, J. C., Rozowsky, J., Zhang, J., Chhetri, S. B., Zhang, J., Victorsen, A., White, K. P., Visel, A., Yeo, G. W., Burge, C. B., Lecuyer, E., Gilbert, D. M., Dekker, J., Rinn, J., Mendenhall, E. M., Ecker, J. R., Kellis, M., Klein, R. J., Noble, W. S., Kundaje, A., Guigo, R., Farnham, P. J., Cherry, J. M., Myers, R. M., Ren, B., Graveley, B. R., Gerstein, M. B., Pennacchio, L. A., Snyder, M. P., Bernstein, B. E., Wold, B., Hardison, R. C., Gingeras, T. R., Stamatoyannopoulos, J. A. & Weng, Z. (2020) Expanded encyclopaedias of DNA elements in the human and mouse genomes, Nature. 583, 699-710.
Author: alexmoise1
Session Name: mm10 RAR cREs Mouse Dhrs3
Genome Assembly: mm10
Creation Date: 2024-08-16
Views: 894 		1723795200 894
Description: CRX
Author: ALLDEREP
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-12
Views: 80 		1726128000 80
Description: For Bioinformatics class assignment purpose, to be viewed by the instructors.
Author: hemib
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2024-10-08
Views: 57 		1728374400 57
Description: CUT&RUN dataset for Six3 (with antibodies Six3_abs and Six3_ori), Six6, and IgG control for mouse embryonic retinas at E13.5.
Author: Wei_einstein
Session Name: PlosOne
Genome Assembly: mm10
Creation Date: 2024-08-08
Views: 676 		1723104000 676
Description: hg19 RHO altered for quiz 2
Author: ClaytonFannin
Session Name: hg19 RHO altered
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 69 		1725264000 69
Description: GWAS endometriosis associations around RERG
Author: Pkgg77
Session Name: RERG - ras ER reg high in uterus CHR12
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 1468 		1721635200 1468
Description: This session shows how UShER can place H5N1 sequences on the tree of viral samples. Here are the steps to replicate a similar session. First find an example viral sequence such as SRR28752449_HA_cns.fa in this repository: https://github.com/andersen-lab/avian-influenza/tree/master/fasta With the fasta sequence copied follow these steps. 1. Navigate to UShER, quick link: https://usher.bio 2. Paste in a sequence: >Consensus_SRR28752449_HA_cns_threshold_0.5_quality_20 ATGGAGAACATAG... 3. Click "Upload" 4. Click "View in Genome Browser" 5. Note the placement near the branch of H5N1 near other cattle lineages (click session image on the left to see, find the light blue horizontal line highlighting Consensus_SRR28752449).
Author: brianlee
Session Name: H5N1
Genome Assembly: hub_4086371_GCF_000864105.1
Creation Date: 2024-07-01
Views: 1470 		1719820800 1470
Description: hg38 CNGB1 alt polyA isoforms
Author: renkejhsph
Session Name: hg38 CNGB1 alt polyA isoforms
Genome Assembly: hg38
Creation Date: 2024-06-19
Views: 1009 		1718784000 1009
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_1
Genome Assembly: hg19
Creation Date: 2024-10-29
Views: 51 		1730188800 51
Description: HumanDevelopingRetinaAtlas
Author: zhenzuo2
Session Name: HumanDevelopingRetinaAtlas
Genome Assembly: hg38
Creation Date: 2024-06-06
Views: 756 		1717660800 756
Description: "A two-step regulatory mechanism dynamically controls histone H3 acetylation by SAGA complex at growth-related promoters" paper genome wide data (Zencir et al., 2024)
Author: sevil
Session Name: GSE268170_BIGWIG FILES
Genome Assembly: sacCer3
Creation Date: 2024-06-05
Views: 478 		1717574400 478
Description: All QTLs from datasets in our S. cerevisiae QTL datasets reanalysis. QTL Track Name Format: - GENE::dataset_name$$LOD, where LOD is rounded to the nearest integer Relevant Fields: - Color: blue for mRNA QTLs, brown for protein QTLs, black for xQTLs - Color Intensity: darker with increasing QTL LOD - Strand: direction of QTL as considered in the paper - Arrows: right for positive QTL effect
Author: matthewf
Session Name: Reanalysis of QTL Datasets
Genome Assembly: sacCer3
Creation Date: 2024-08-05
Views: 102 		1722844800 102
Description: long retinal isoform of shisa5
Author: JonathanM70
Session Name: hg38 shisa5 long isoform
Genome Assembly: hg38
Creation Date: 2024-06-03
Views: 367 		1717401600 367
Description: Chip-seq
Author: ucscfzl
Session Name: SIRT3KO
Genome Assembly: hg38
Creation Date: 2024-08-21
Views: 97 		1724227200 97
Description: nair
Author: xiaopei
Session Name: hg38_xiaopei_May20
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 558 		1716192000 558
Description: test
Author: xiaopei
Session Name: hg38_test2
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 461 		1716192000 461
Description: test 1
Author: xiaopei
Session Name: hg38_test1
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 355 		1716192000 355
Description: ATAC-seq YZ
Author: Yichao Zhou
Session Name: NewATAC-seq analysis
Genome Assembly: mm10
Creation Date: 2024-05-20
Views: 63 		1716192000 63
Description: hg18_rnaseq
Author: hyfydky
Session Name: hg18_rnaseq
Genome Assembly: hg18
Creation Date: 2024-05-18
Views: 173 		1716019200 173
Description: hg38_GSE176016
Author: hyfydky
Session Name: hg38_GSE176016
Genome Assembly: hg38
Creation Date: 2024-05-10
Views: 742 		1715328000 742
Description: c.4619T>G P.Leu1540Arg Revel score
Author: sk202
Session Name: VWF_1540
Genome Assembly: hg19
Creation Date: 2024-05-16
Views: 169 		1715846400 169
Description: test
Author: yunna
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-05-02
Views: 348 		1714636800 348
Description: isPCR hits in two adjacent genes. Shows amplicons expected if using mRNA as template.
Author: netherlands2024
Session Name: hg19_isPCR
Genome Assembly: hg19
Creation Date: 2024-04-29
Views: 1243 		1714377600 1243
Description: CRX binding sites for HTT gene in mouse genome
Author: eraterman
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1568 		1712736000 1568
Description: CRX binding sites for THRB gene in mouse genome
Author: eraterman
Session Name: mm9 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1166 		1712736000 1166
Description: CRX binding sites for PDE6A gene in mouse genome
Author: eraterman
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 467 		1712736000 467
Description: CRX binding sites for RCVRN gene in mouse genome
Author: eraterman
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 204 		1712736000 204
Description: CRX binding sites for RHO gene in mouse genome
Author: eraterman
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 202 		1712736000 202
Description: class assignment 4-10-24
Author: ShMaBe
Session Name: CRX ChIP Seq wt Nrl
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 183 		1712736000 183
Description: lab 4-3
Author: Ruffi2ec
Session Name: Lab due 4-3
Genome Assembly: hg38
Creation Date: 2024-04-04
Views: 182 		1712217600 182
Description: This session contains a custom track showing near coding regions in PanelApp green genes, as described in the article "Systematic identification of disease-causing promoter and untranslated region variants in 8,040 undiagnosed individuals with rare disease" Martin-Geary et al 2024
Author: ageary
Session Name: CRDG 'Near coding regions' Martin-Geary et al '24
Genome Assembly: hg38
Creation Date: 2024-04-05
Views: 226 		1712304000 226
Description: yes
Author: aryanzandi123
Session Name: REST and Co-repressor Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 18 		1733904000 18
Description: a demo
Author: xiyuan09
Session Name: xyuan2024-hg19
Genome Assembly: hg19
Creation Date: 2024-03-30
Views: 399 		1711785600 399
Description: U2AF2 iCLIP (Sutandy et al 2018) and eCLIP (ENCODE) processed with racoon_clip
Author: melinak
Session Name: U2AF2_iCLIP_and_eCLIP
Genome Assembly: hg38
Creation Date: 2024-04-12
Views: 195 		1712908800 195
Description: Ribosome Footprinting profile of miR181a/b-1 knockout vs wildtype in mouse thymocytes with three samples each. Data from Verheyden and Klostermann et al. 2024 (https://www.biorxiv.org/content/10.1101/2023.09.08.556730v1)
Author: melinak
Session Name: miR181_RibosomeFootprint_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-26
Views: 585 		1711440000 585
Description: hg19 RHO #2 Quiz #@
Author: rchelsea
Session Name: hg19 RHO #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 51 		1725264000 51
Description: hg19 RHO Quiz #1
Author: rchelsea
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 90 		1725264000 90
Description: hg19 RHO
Author: madisonflorenz
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 81 		1725264000 81
Description: miR181-eCLIP data from Verheyden and Klostermann et.al. 2024. Shown are the chimeric and non-chimeric crosslinks for four conditions: Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout Ago2 IP with miR181a/b-1 knockout and a following enrichment for miR181 In addition binding sites are shown for Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout And the differential binding sites of Ago2 IP with miR181a/b-1 knockout vs Ago2 IP
Author: melinak
Session Name: miR181-eCLIP_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-25
Views: 333 		1711353600 333
Description: This browser track accompanies the Alternative Proteome Detection Project out of the Sheynkman Lab at the University of Virginia.
Author: emilyfwatts
Session Name: Alternative-Proteome-Detection
Genome Assembly: hg38
Creation Date: 2024-03-15
Views: 374 		1710489600 374
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2024_fig6
Genome Assembly: hg19
Creation Date: 2024-03-11
Views: 727 		1710144000 727
Description: Test session for Module 7 of BINF 6310.
Author: oconnor.ea
Session Name: oconnor-binf6310
Genome Assembly: hg38
Creation Date: 2024-03-01
Views: 870 		1709280000 870
Description: Blue ticks every 10000 bases. Red ticks every 100 bases, skip 100
Author: lizkiefer
Session Name: hg38_chr22_KieferLiz
Genome Assembly: hg38
Creation Date: 2024-02-27
Views: 1337 		1709020800 1337
Description: ATAC-seq of MaSC(mammary stem cell)
Author: woaichixiangcai
Session Name: MaSC_ATAC
Genome Assembly: mm10
Creation Date: 2024-02-18
Views: 664 		1708243200 664
Description: Track Decorators help page: https://genome.ucsc.edu/goldenPath/help/decorator.html
Author: BGMP2024
Session Name: Track_Decorators
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 629 		1706428800 629
Description: Highlighted exons 5-8 of ENST00000269305.9
Author: BGMP2024
Session Name: hg38_BGMP2024_Ex
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 749 		1706428800 749
Description: practice
Author: jordancibellis
Session Name: hg19_480L
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 579 		1706083200 579
Description: BIO480L Spring 24
Author: penguinttoes
Session Name: hg19_newsome
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 329 		1706083200 329
Description: This is Harshini and Jenn's steps to solve FAD!
Author: creminslab
Session Name: FAD_Harshini_hg38
Genome Assembly: hg38
Creation Date: 2024-01-19
Views: 319 		1705651200 319
Description: te
Author: aryanzandi123
Session Name: Polycomb and Chromatin-Binding Proteins Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 16 		1733904000 16
Description: This session features a track hub with MaveDB experiment datasets mapped to the GRCh38 reference genome
Author: mcline
Session Name: MaveDB
Genome Assembly: hg38
Creation Date: 2024-04-03
Views: 269 		1712131200 269
Description: PE2 editing efficiency in synHEK3 reporters in K562 cells
Author: lxyttpp912
Session Name: hg38_synHEK3_hub
Genome Assembly: hg38
Creation Date: 2023-12-26
Views: 756 		1703577600 756
Description: Differentially methylated CGIs under DiPRO/ZNF555 knockdown in human rhabdomyosarcoma and myoblast cells (shDiPRO1 vs. non-targeting shCTL)
Author: dr_finder
Session Name: metCGI_ZNF55/DiPRO1_2023
Genome Assembly: hg38
Creation Date: 2023-12-20
Views: 191 		1703059200 191
Description: Coverage tracks from SF3B1-humanized yeast treated with splicing inhibitors Plad-B and Thail-A from Hunter et al. Published in RNA
Author: mannyares
Session Name: Hunter_etal
Genome Assembly: sacCer3
Creation Date: 2023-12-13
Views: 728 		1702454400 728
Description: may
Author: xiaopei
Session Name: hg38_xiaopei_May21
Genome Assembly: hg38
Creation Date: 2024-05-21
Views: 160 		1716278400 160
Description: bigWig files for promoter NDR resetting after replication (Zencir et al.,2024)
Author: julien_soudet
Session Name: EdU_replication
Genome Assembly: sacCer3
Creation Date: 2024-05-31
Views: 152 		1717142400 152
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. View of AS imprinted region as shown in Figure 7A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: AS_Locus_Fig7A_Fugon_2024
Genome Assembly: hg19
Creation Date: 2023-12-06
Views: 144 		1701849600 144
Description: A snapshot from the genome browser displaying the enrichment of H3K27ac in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 566 		1701590400 566
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 368 		1701590400 368
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 342 		1701590400 342
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 279 		1701590400 279
Description: The UCSC Browser show the enrichment of the H3K18la signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 295 		1701590400 295
Description: The UCSC Browser show the enrichment of the H3K18la signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 285 		1701590400 285
Description: A snapshot from the genome browser displaying the enrichment of H3K18la in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 284 		1701590400 284
Description: The UCSC Browser show the enrichment of the H3K18la signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 287 		1701590400 287
Description: ZC3 ChIP
Author: yannfrey
Session Name: ZC3 ChIP
Genome Assembly: hg38
Creation Date: 2023-11-26
Views: 434 		1700985600 434
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. Zoomed in view of the MAGEL2 anchor region as shown in Figure 9A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: MAGEL2_Fig9A _Fugon_2024
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 105 		1721635200 105
Description: RNA omics stuff
Author: nrpowell
Session Name: 2023_Nov_CYP3A4_fold/m6a/eclip_comparison
Genome Assembly: hg38
Creation Date: 2023-11-20
Views: 586 		1700467200 586
Description: Tdg&p53
Author: [email protected]
Session Name: Tdg&p53
Genome Assembly: mm10
Creation Date: 2023-11-18
Views: 321 		1700294400 321
Description: PDE6C&RBP4
Author: gracewattawa
Session Name: PDE6C&RBP4
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 366 		1699948800 366
Description: p
Author: julianna0220
Session Name: PDE6C
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 369 		1699948800 369
Description: GUCA1B&GUCA1A
Author: gracewattawa
Session Name: GUCA1B&GUCA1A
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 231 		1699948800 231
Description: d
Author: julianna0220
Session Name: GUCA1B
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 314 		1699948800 314
Description: mm9 PDE6C/RBP4 Multiomics
Author: chelseadonovan
Session Name: mm9 PDE6C/RBP4 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 331 		1699948800 331
Description: NRL&CPNE6
Author: gracewattawa
Session Name: NRL&CPNE6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 218 		1699948800 218
Description: d
Author: julianna0220
Session Name: cone6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 314 		1699948800 314
Description: nrl version of everything
Author: joshraynes
Session Name: Nrl version
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 303 		1699948800 303
Description: RHO&H1foo
Author: gracewattawa
Session Name: RHO&H1foo rnaseq
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 201 		1699948800 201
Description: pho
Author: julianna0220
Session Name: RHO Pho
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 321 		1699948800 321
Description: mm9 GUCA1B/GUCA1A Multiomics
Author: chelseadonovan
Session Name: mm9 GUCA1B/GUCA1A Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 291 		1699948800 291
Description: mm9 NRL/CPNE6 Multiomics
Author: chelseadonovan
Session Name: mm9 NRL/CPNE6 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 337 		1699948800 337
Description: RNASEQnrl
Author: gracewattawa
Session Name: RNASEQnrl
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 307 		1699948800 307
Description: mm9 RHO Multiomics
Author: chelseadonovan
Session Name: mm9 RHO Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 322 		1699948800 322
Description: BINF6310
Author: varun1010
Session Name: hg38_assignment7_1
Genome Assembly: hg38
Creation Date: 2023-11-12
Views: 326 		1699776000 326
Description: RCVRN gene
Author: Isabella Lindblad
Session Name: 11-9_mouse3_RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 319 		1699516800 319
Description: mm9 RCVRN CBR sites
Author: chelseadonovan
Session Name: mm9 RCVRN CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 321 		1699516800 321
Description: RCVRN
Author: kenzie.prettyman
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 316 		1699516800 316
Description: rcvrn
Author: julianna0220
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 318 		1699516800 318
Description: HTT
Author: kenzie.prettyman
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 353 		1699516800 353
Description: mm9 HTT CBR sites
Author: chelseadonovan
Session Name: mm9 HTT CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323 		1699516800 323
Description: HTT
Author: julianna0220
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 316 		1699516800 316
Description: CRX binding regions of PDE6A
Author: taylo2ga
Session Name: Mouse PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 321 		1699516800 321
Description: THRB
Author: kenzie.prettyman
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 316 		1699516800 316
Description: thrb
Author: julianna0220
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 307 		1699516800 307
Description: mm9 THRB CBR sites
Author: chelseadonovan
Session Name: mm9 THRB CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 324 		1699516800 324
Description: PDE6A
Author: kenzie.prettyman
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 317 		1699516800 317
Description: RHO nrl- onlh
Author: joshraynes
Session Name: RHO Nrl-
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 298 		1699516800 298
Description: PDE6A
Author: julianna0220
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 318 		1699516800 318
Description: mm9 PDE6A CBR sites
Author: chelseadonovan
Session Name: mm9 PDE6A CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 318 		1699516800 318
Description: Viewing Mouse Genome 2007 (mm9), RHO gene with CRX binding sites
Author: chelseadonovan
Session Name: mm9 RHO CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 322 		1699516800 322
Description: crx binding
Author: julianna0220
Session Name: CRX JP
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 318 		1699516800 318
Description: CBR data in PDE6A gene on mouse mm9 genome
Author: ryleestrother
Session Name: CBR PDE6A mm9
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 318 		1699516800 318
Description: CBR regions of the RCVRN gene
Author: taylo2ga
Session Name: Mouse RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 314 		1699516800 314
Description: crx binding sites
Author: gracewattawa
Session Name: CRX binding sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 317 		1699516800 317
Description: CRX binding regions of the gene HTT
Author: taylo2ga
Session Name: Mouse HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 312 		1699516800 312
Description: CRX binding sites wt and mutant
Author: kenzie.prettyman
Session Name: CRX
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 336 		1699516800 336
Description: Enke Bio481 THRB Gene in mm9
Author: cooperki
Session Name: THRB_Mouse
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 299 		1699516800 299
Description: RHO gene
Author: Isabella Lindblad
Session Name: 11-9_mouse_RHO
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 305 		1699516800 305
Description: CRX binding regions of the THRB gene
Author: taylo2ga
Session Name: Mouse THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 308 		1699516800 308
Description: binf6310 hg38 custom track
Author: sydneycole
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-05
Views: 437 		1699171200 437
Description: test.bed custom tracks
Author: rpatel01
Session Name: binfmodule7
Genome Assembly: hg38
Creation Date: 2023-11-03
Views: 702 		1698998400 702
Description: BINF6310 MODULE 7
Author: Pruthweish27
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 597 		1698739200 597
Description: BINF6310 MODULE 7
Author: sreepoojitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 328 		1698912000 328
Description: ancestry - taster nontaster
Author: fareehaa_ahm
Session Name: ancestry
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 317 		1698912000 317
Description: hg19 TAS2R38 Ancestry Data
Author: chelseadonovan
Session Name: hg19 TAS2R38 Ancestry Data
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 328 		1698912000 328
Description: ancestry
Author: julianna0220
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 301 		1698912000 301
Description: Ancestry.com SNPs
Author: ryleestrother
Session Name: hg19 ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 300 		1698912000 300
Description: Ancestry.com data
Author: kenzie.prettyman
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 309 		1698912000 309
Description: custom tracks - BIO 481
Author: fareehaa_ahm
Session Name: MYBPC1_customtracks_Fareeha
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 335 		1698912000 335
Description: MYBPC1
Author: julianna0220
Session Name: MYBPC1 JP
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 309 		1698912000 309
Description: Final with descriptions
Author: rahrigHK
Session Name: MYBPC1 Activity (Final)
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 316 		1698912000 316
Description: MYBPC1 session
Author: joshraynes
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 302 		1698912000 302
Description: MYBPC1 assignment
Author: kenzie.prettyman
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 314 		1698912000 314
Description: hg19 assembly showing MYBPC1 gene & custom tracks
Author: chelseadonovan
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 318 		1698912000 318
Description: BINF_6310 Module 7
Author: kandalkarankita
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 305 		1698912000 305
Description: BINF-6310
Author: Harshini144
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 307 		1698912000 307
Description: BINF 6310 Module 7
Author: nallaboluvikas
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-01
Views: 938 		1698825600 938
Description: Custom tracks for genomic variants on chr22
Author: sdzzwzy
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-11-01
Views: 317 		1698825600 317
Description: BINF6310
Author: SaradaPriya_Mns
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 535 		1698739200 535
Description: binf6310
Author: varun1010
Session Name: hg38_assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 414 		1698739200 414
Description: BINF 6310
Author: Pavitra Dass
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 330 		1698739200 330
Description: BINF6310
Author: Meghana09
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 411 		1698739200 411
Description: custom link for assignment7
Author: srivastava.sank
Session Name: assignment7track
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 306 		1698739200 306
Description: DAG session
Author: DaniGonzalez
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 47 		1730361600 47
Description: Incorporating a customized track
Author: Tanvi
Session Name: test
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 327 		1698739200 327
Description: BINF6310 Assignment: Incorporating a customized track using the provided bed file into the UCSC Genome Browser. Submitted by AashkaB
Author: aashka.b
Session Name: test_session_AB
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 319 		1698739200 319
Description: This is a session run as a part of assignment for the course BINF6310
Author: Unnati Jonnavithula
Session Name: UJ1
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 322 		1698739200 322
Description: this is the assignment
Author: yuqiaotang
Session Name: 6300assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 337 		1698739200 337
Description: Module 7 - BIF6310
Author: trangtu97
Session Name: hg38_human
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 314 		1698652800 314
Description: test for school
Author: tojaga.m
Session Name: Eosinophil
Genome Assembly: hg38
Creation Date: 2023-10-26
Views: 331 		1698307200 331
Description: Harvard MCB197 course, histone modifications in human tissues
Author: amandajoyward
Session Name: MCB197-histone
Genome Assembly: hg38
Creation Date: 2023-10-20
Views: 312 		1697788800 312
Description: hg38 Blat of in situ hybridization probes to NTRK2.
Author: amandajoyward
Session Name: MCB197-NTRK2 probes
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 288 		1698652800 288
Description: BINF 6310
Author: pavan kumar
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 312 		1698652800 312
Description: Quiz 10/12
Author: jschifflin
Session Name: HTT gene assignment
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 634 		1697097600 634
Description: hg38 HTT gene BIO481 - 10/12/23
Author: fareehaa_ahm
Session Name: hg38_HTT
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 480 		1697097600 480
Description: hg38 genome viewing HTT gene with GENCODE V32 and Simple Repeats
Author: chelseadonovan
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 862 		1697011200 862
Description: htt gene
Author: julianna0220
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 389 		1697011200 389
Description: haethethntgnarangr
Author: jrkenne
Session Name: hg19_hbg
Genome Assembly: hg19
Creation Date: 2023-10-02
Views: 623 		1696233600 623
Description: Hemoglobin
Author: Biniyam
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-09-28
Views: 480 		1695888000 480
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD in expressed in red blood cells almost exclusively.
Author: laparidis.e
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-11-05
Views: 312 		1699171200 312
Description: Methylation data for human and mouse
Author: masarun
Session Name: masa_test
Genome Assembly: hg38
Creation Date: 2023-09-21
Views: 891 		1695283200 891
Description: BAF and histone markers in SS mouse model
Author: Li Li
Session Name: mouse_SS_BAF_histoneMarkers
Genome Assembly: mm10
Creation Date: 2024-06-27
Views: 151 		1719475200 151
Description: Chip seq
Author: xiaopei
Session Name: Chip_seq_A
Genome Assembly: hg38
Creation Date: 2024-06-27
Views: 125 		1719475200 125
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: The landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the comprehensive reference Human Genome GRCh38 , indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous peaks of microsatellite density throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of GRCh38 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,088,269,832 Total peak count: 208,638 HMDP count: 3,480 MMDP count: 26,310 LMDP count: 178,848 Session Name: Microsatellite Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: GRCh38.p14
Genome Assembly: hg38
Creation Date: 2023-09-10
Views: 155 		1694332800 155
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: "The microsatellite, also called short tandem repeats (STRs), density landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the complete reference Human Genome T2T-CHM13, indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous microsatellite density peaks throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of T2T-CHM13 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,117,275,501 Total peak count: 244,729 HMDP count: 8,823 MMDP count: 36,257 LMDP count: 199,649 Microsatellites Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: CHM13v2.0
Genome Assembly: hub_3671779_hs1
Creation Date: 2023-09-10
Views: 310 		1694332800 310
Description: zoom in PBK and find out all the upstream 200base SNPs
Author: ZhengJi
Session Name: hg38_upstream200SNPs
Genome Assembly: hg38
Creation Date: 2023-09-05
Views: 997 		1693900800 997
Description: probes for FISH on human cells and tissues
Author: [email protected]
Session Name: hg19_FISH_probes
Genome Assembly: hg19
Creation Date: 2024-01-17
Views: 288 		1705478400 288
Description: Crouch DRIP-Seq rDNA annotations
Author: apratim.mitra
Session Name: crouch-dripseq-rdna-annotations-diff
Genome Assembly: hub_4200124_mm10
Creation Date: 2023-08-31
Views: 13 		1693468800 13
Description: class 3
Author: hekn
Session Name: “Fall23 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 428 		1693468800 428
Description: Beginner Activity for UCSC Genome Browser (BIO481)
Author: fareehaa_ahm
Session Name: Fall23 Worm BIO481 group4
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 454 		1693468800 454
Description: genomic 481 in class activity
Author: ryleestrother
Session Name: Fall23 Yeast BIO481 group2
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 358 		1693468800 358
Description: Group Activity #1 from Group 1.
Author: jschifflin
Session Name: Fall23 Yeast BIO481 Group1
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 371 		1693468800 371
Description: group 5 version of mouse project
Author: julianna0220
Session Name: Fall23 Mouse481 group5
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 354 		1693468800 354
Description: Mouse genome group project group 6
Author: joshraynes
Session Name: Fall23 MouseBio481 Group 6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 324 		1693468800 324
Description: Mouse genome (mm9) for Group #6 in BIO481
Author: chelseadonovan
Session Name: Fall23 Mouse BIO481 Genome Group#6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 215 		1693468800 215
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: shancon1200
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-08-31
Views: 353 		1693468800 353
Description: Show every Lysine site on POMC 1st extron on hg38.
Author: ZhengJi
Session Name: hg38_POMC1stextronK
Genome Assembly: hg38
Creation Date: 2023-08-31
Views: 353 		1693468800 353
Description: hg18_rnaseq3
Author: hyfydky
Session Name: hg18_rnaseq3
Genome Assembly: hg18
Creation Date: 2024-05-20
Views: 169 		1716192000 169
Description: Human FoxP2 gene; Fa23 Genomic class Enke
Author: renkejhsph
Session Name: hg38 Fox2P MoR Ch2 1st Person: Conservation
Genome Assembly: hg38
Creation Date: 2023-08-28
Views: 504 		1693209600 504
Description: BTD MANE in HG38 UCSC browser
Author: lilinatera
Session Name: hg38_BTD_MANE
Genome Assembly: hg38
Creation Date: 2023-08-27
Views: 474 		1693123200 474
Description: Clinically relevant pesudogenes sequences [high homology: orange; low homology: light orange, as per Mandelker et al. 2016; PMID: 27228465. Example: ALG1_0.26_241_1_241; Gene Name _ Mappability _ Positions <1 _ % Positions <1 _ Max contiguous bases; the 'ALG1' gene feature at position chr16:5127843-5128083, Exon+/-65bp has a 'Mappabilty score' of 0.26 (1= mapping only once to the genome whereas a score lower than 1 equates to homology else where on the genome. 241 'Positions' (bases) affected, 100'% of these Positions' and 241 'Max contiguous bases' within the Exon+/-65bp that are affected as indicated by having a mappability score below 1.
Author: Yog77
Session Name: hg19_ClinicalHomology
Genome Assembly: hg19
Creation Date: 2017-01-17
Views: 1566 		1484640000 1566
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_GBR_CHS
Genome Assembly: hg19
Creation Date: 2023-08-23
Views: 49 		1692777600 49
Description: 2
Author: jschifflin
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 371 		1693900800 371
Description: This session is a view of the 10 capstone genes in the SSPsyGene project. It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:ARID1B ASXL3 CACNA1G CHD8 DLL1 GABRA1 KMT2C SCN2A SHANK3 SMARCC2
Author: brianlee
Session Name: Capstone_Genes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 1091 		1692086400 1091
Description: This session is a view of the 10 capstone genes in the SSPsyGene project in order of chromosomes (a gene on chr2 before the gene on chr5). It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:SCN2A GABRA1 DLL1 ARID1B KMT2C SMARCC2 CHD8 CACNA1G ASXL3 SHANK3
Author: brianlee
Session Name: CapstoneGenes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 496 		1692086400 496
Description: Testing public session
Author: gperez2
Session Name: Testing_public_session
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 435 		1691049600 435
Description: BioInf 6310 bed file upload
Author: Neveen Mohamed
Session Name: nv23
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 342 		1698739200 342
Description: ATAC-seq pile-up tracks for fruit fly clock neurons. For more details and citation: https://doi.org/10.1101/2023.08.15.553315
Author: yegeyy
Session Name: ATAC wildtype and per01 pile-up tracks
Genome Assembly: dm6
Creation Date: 2023-08-08
Views: 342 		1691481600 342
Description: Test
Author: gperez2
Session Name: brca1
Genome Assembly: hg38
Creation Date: 2023-10-27
Views: 328 		1698393600 328
Description: E5ind and NF54-GEXP02-Tom H3K9me3 dynamics at the onset of gam. dev.
Author: sandracula
Session Name: H3K9me3 dynamics at the onset of gam. dev.
Genome Assembly: hub_2790993_GCA_000002765.3
Creation Date: 2024-03-12
Views: 244 		1710230400 244
Description: d
Author: julianna0220
Session Name: hg19 RHO JP
Genome Assembly: hg19
Creation Date: 2023-09-04
Views: 356 		1693814400 356
Description: eclip comparison 2023
Author: nrpowell
Session Name: eCLIP_comparison_May_2023
Genome Assembly: hg38
Creation Date: 2023-05-23
Views: 2339 		1684828800 2339
Description: This custom session includes manually selected blood-related DNA methylation data measured by bisulfite sequencing. This initial session include 121 tracks updated until 2023 June.
Author: dai905
Session Name: hg38_bloodcell_121
Genome Assembly: hg38
Creation Date: 2023-06-02
Views: 277 		1685692800 277
Description: rs142783062
Author: nrpowell
Session Name: rs142783062
Genome Assembly: hg38
Creation Date: 2023-06-01
Views: 1937 		1685606400 1937
Description: Epigenetic selectivity of TopoIIα redistribution and histone eviction of anthracyclines Anthracyclines act by disrupting the interface of TopoII and DNA and by evicting histones. The anthracycline-specific redistribution of TopoII and its association with histone eviction were addressed in K562 cells. Chromatin immunoprecipitation, followed by deep sequencing (ChIP-seq) against endogenously tagged TopoIIα, and transposase-accessible chromatin with sequencing (ATAC-seq) was performed 4 hours after anthracycline exposure.
Author: mtan1
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-08-11
Views: 390 		1691740800 390
Description: Data Viewer
Author: allenbellamom
Session Name: hg38_DC
Genome Assembly: hg38
Creation Date: 2023-10-25
Views: 297 		1698220800 297
Description: GR ChIP
Author: tsuzuki
Session Name: PC_hg38
Genome Assembly: hg38
Creation Date: 2023-05-17
Views: 2088 		1684310400 2088
Description: This session describes the genomic location for LD-SNPs of rs7255249 (r2>0.8). (Top) The plot shows the eQTL association of local variants with CHST8 expression in breast mammary tissues. (Middle) GeneHancer track shows probable interactions between regulatory elements and CHST8 promoter. (Bottom) DHS region, H3K4me1, H3K4me3, and H3K27ac marks present putative epigenetic regulation. DHS signals of each cells are from ENCODE. Histone modification signals of MCF7, HMEC-1 (mammary epithelial cell, 50-year-old female), and HMEC-2 (breast epithelium, 51-year-old female) are also from ENCODE, whereas histone modification results of vHMEC (Breast_vHMEC.Donor_RM035) and BMC (Breast_Myoepithelial_Cells) are from Roadmap Epigenomics. Histone modification signals from different biosamples are grouped in order by H3K4me3, H3K4me1, and H3K27ac and presented them as overlaid tracks.
Author: Wen-Cheng
Session Name: Breast_rs7255249
Genome Assembly: hg19
Creation Date: 2023-05-18
Views: 316 		1684396800 316
Description: UCSC browser session associated with manuscript: PMID: 38032818 Title: Chromosome-specific maturation of the epigenome in the Drosophila male germline
Author: jamesanderson12358
Session Name: analysis230508___UCSC_session_germline_MS
Genome Assembly: dm6
Creation Date: 2023-05-08
Views: 404 		1683532800 404
Description: inputA.bed and inputA.bedgraph
Author: amykle
Session Name: inputA from usr 16
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 639 		1683187200 639
Description: hugo example RTS
Author: Example
Session Name: hg38_hugo2023
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 564 		1683187200 564
Description: Mouse meth
Author: danilapror
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2023-05-04
Views: 646 		1683187200 646
Description: OMICS_HW_2_Sokolov_AA
Author: hazirliver1
Session Name: mm10_Sokolov_AA
Genome Assembly: mm10
Creation Date: 2023-05-03
Views: 554 		1683100800 554
Description: WGBS and RNA-seq data from ENCODE - T cells - GN12878 - NK - Pancr end_OTHERS Looking at gene CD55!
Author: michalula
Session Name: WGBS_RNA_ENCODE_T_GN12878_NK_Pancr_end_OTHERS_CD55
Genome Assembly: hg38
Creation Date: 2023-05-01
Views: 782 		1682928000 782
Description: PSIP ChIP (GSE175482)
Author: tsuzuki
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-04-09
Views: 1098 		1681027200 1098
Description: Gene project for genetics class
Author: bji20
Session Name: Gene Project Final
Genome Assembly: hg38
Creation Date: 2023-04-07
Views: 843 		1680854400 843
Description: Tracks from GSE212386. Titration of H3K9me3 and H3K27ac antibodies in ChIP, as well as replicates of H3K9me2 IPs.
Author: ari11
Session Name: GSE212386
Genome Assembly: hg38
Creation Date: 2023-04-05
Views: 755 		1680681600 755
Description: CUT&RUN data for "Stress increases sperm respiration and motility in mice and men." Numbers in the sample names are associated with treatment condition as follows: Vehicle: 4, 5, 10, 12 Cort: 2, 3, 7, 8, 9
Author: nickole.kanyuch
Session Name: CUT&RUN_NM_03-2023
Genome Assembly: mm10
Creation Date: 2023-03-28
Views: 76 		1679990400 76
Description: BS assay and gRNA tracks for ATRT synthetic lethal candidate genes
Author: matejboros
Session Name: hg19_custom_track
Genome Assembly: hg19
Creation Date: 2023-03-07
Views: 1001 		1678176000 1001
Description: Tissue-level Atlas of Mouse Isoforms. We used full-length cDNA sequencing and the Mandalorion tool to identify and quantify high confidence transcript Isoforms for a variety of mouse tissues
Author: vollmers
Session Name: TAMI
Genome Assembly: mm39
Creation Date: 2024-01-25
Views: 479 		1706169600 479
Description: gene_expression_GM12878
Author: [email protected]
Session Name: hg19_expression_GM12878
Genome Assembly: hg19
Creation Date: 2023-01-24
Views: 1192 		1674547200 1192
Description: these are the 4 variants to show bruce CTs in sessions
Author: cincinnati2023
Session Name: hg38_4vars
Genome Assembly: hg38
Creation Date: 2023-01-26
Views: 595 		1674720000 595
Description: Wyatt Dano Bioinformatics hands on session gene public session
Author: wpd20
Session Name: MCR1 Gene
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 315 		1698048000 315
Description: Human Chromosome 22 from the Human Genome Consortium build 38 (the latest annotated reference assembly of the human genome)
Author: elittlestone
Session Name: HGC/38
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 315 		1698048000 315
Description: tRNA
Author: ck-j
Session Name: tRNA
Genome Assembly: hg38
Creation Date: 2022-12-16
Views: 585 		1671177600 585
Description: hg19 RHO gene with Multiz Allignments and Basewise Conservation (phyloP)
Author: chelseadonovan
Session Name: hg19 RHO Multiz Alignments
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 358 		1693900800 358
Description: ChIP-seq of Histone 3 Acetylation (H3ac) marks.
Author: HanZhang-
Session Name: H3ac_ChIP
Genome Assembly: hg38
Creation Date: 2023-08-11
Views: 302 		1691740800 302
Description: This data has been made public to provide access to peer reviewers
Author: VetrieLab
Session Name: BV173 ChIP Datasets_Scott et al
Genome Assembly: hg38
Creation Date: 2022-11-15
Views: 560 		1668499200 560
Description: BALB/c mouse tissue level transcriptome atlas
Author: msadams
Session Name: BALB/c mouse transcriptome
Genome Assembly: mm39
Creation Date: 2022-08-09
Views: 620 		1660032000 620
Description: Contribution tracks for peak 2
Author: lacey.walker
Session Name: peak2
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 2616 		1665820800 2616
Description: Contribution tracks for peak 0
Author: lacey.walker
Session Name: peak0
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 1522 		1665820800 1522
Description: Contribution tracks for peak 1
Author: lacey.walker
Session Name: peak1
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 616 		1665820800 616
Description: Genome-wide characterization of mitochondrial DNA methylation in human brain. Matthew Devall1, Darren M. Soanes, Adam R. Smith, Emma L. Dempster, Rebecca G. Smith, Joe Burrage, Artemis Iatrou, Eilis Hannon, Claire Troakes, Karen Moore, Paul O’Neill, Safa Al-Sarraj, Leonard Schalkwyk, Jonathan Mill, Michael Weedon & Katie Lunnon The mitochondrial genome is characterized by specific regions of methylation. Graph showing average % methylation at each cytosine in the mitochondrial genome from superior temporal gyrus (STG) and cerebellum (CER) brain tissue from seven donors free of neurodegenerative disease, including three males and four females using a targeted bisulfite sequencing method.
Author: dmsoanes
Session Name: chrM_methylation_STG_CER
Genome Assembly: hg38
Creation Date: 2022-10-04
Views: 715 		1664870400 715
Description: Used for CMSE 411
Author: CVan0124
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-23
Views: 566 		1663920000 566
Description: HIV-1 strain NL4-3 mRNA Atlas v1 mRNA transcript models open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: [email protected] Transcript model method: Transcript models were downloaded as FASTA from GenBank:MZ242719.1-MZ242757.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. Max number of sequences for blat = 25, so n=38 was partitioned into two blat runs, sorted by accession. These were viewed as a track in UCSC Genome Browser. MZ242719.1, MZ242720.1, MZ242721.1 are models of unspliced, singly-spliced, and doubly-spliced. "Singly-spliced" and "doubly-spliced" have been commonly used in the literature, but without basis in explicitly defined mRNA models. As you can see, HIV-1 NL4-3 splice isoforms supported by high-quality long reads and reanalysis are more complicated that previously understood. Open reading frames (ORFs) method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. ORF note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. ORF note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. ORF note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_mRNA+ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-21
Views: 426 		1663747200 426
Description: HIV-1 strain NL4-3 mRNA Atlas v1 open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: [email protected] Method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. Note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. Note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. Note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-20
Views: 673 		1663660800 673
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_multi_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 1057 		1663574400 1057
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_single_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 574 		1663574400 574
Description: eCLIP experiments with ligation step allowing identification of miRNA-mRNA pairs and binding sites to around 60 nt resolution. Data generated in the laboratory of Todd Skaar.
Author: nrpowell
Session Name: miRNA_binding_sites_latest_Aug2022
Genome Assembly: hg38
Creation Date: 2022-09-01
Views: 886 		1662019200 886
Description: test
Author: ez176
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-01
Views: 554 		1662019200 554
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation, and includes a custom track that isolates two of these isoforms. This session also includes the transcript expression GTEx track, which shows the frequencies of SORBS1 isoform expression in different types of tissue; Hence, one is able to see how each isoform of SORBS1 is expressed at different frequencies in each tissue type. The two isoforms highlighted within the custom track are great examples of isoform expression, as they are expressed in certain tissue types at vastly different rates.
Author: education
Session Name: hg19_SORBSct
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 702 		1661846400 702
Description: tracks for analysis of ERRg regulatory variants.
Author: agacita
Session Name: ERRg_basic
Genome Assembly: hg38
Creation Date: 2023-06-11
Views: 370 		1686470400 370
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. OMIM has two entries showing that variants on this gene are associated with spinal anomalies. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTomim
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 838 		1661846400 838
Description: The squirrel monkey genome and the TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. In monkeys, the inclusion of an exon in the mature transcript allows for formation of a tail. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: saiBol1_TBXT
Genome Assembly: saiBol1
Creation Date: 2022-08-24
Views: 669 		1661328000 669
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. The "Multiz Alignment" track illustrates which primates have the AluY element and which do not. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTconservation
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 651 		1661328000 651
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTalus
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 947 		1661328000 947
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. For more information regarding this story, visit the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXT
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 723 		1661328000 723
Description: BRCA1 gene region, showing CpG islands and DNA methylation. These regions influence gene expression. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylationAndIslands
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 667 		1660896000 667
Description: DNA methylation patterns with and without bi-sulfite treatment in BRCA1 region. These DNA modifications affect gene regulation. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylation
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 638 		1660896000 638
Description: Transcription factor binding sites and CpG island in BRCA1 region of human hg19 genome assembly. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_tfbs
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 687 		1660896000 687
Description: DMRs and DMPs in relation to H3K4me3 signals of Acute myeloid leukemia samples
Author: bacdao
Session Name: LAML
Genome Assembly: hg38
Creation Date: 2022-08-24
Views: 402 		1661328000 402
Description: POLN and HAUS3 share the first exon.
Author: Dongbo Ding
Session Name: POLN
Genome Assembly: hg19
Creation Date: 2022-08-06
Views: 619 		1659772800 619
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "GWAS" track is enabled and shows common nucleotide variants in the region and provides publications that further explore the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gwas
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 676 		1658390400 676
Description: .....
Author: gperez2
Session Name: rn6_atp4
Genome Assembly: rn6
Creation Date: 2022-07-26
Views: 605 		1658822400 605
Description: Elys DamID in 16-18h Drosophila embryos.
Author: Shevelyov
Session Name: Elys_embryo DamID
Genome Assembly: dm3
Creation Date: 2022-12-14
Views: 539 		1671004800 539
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Human Genome Diversity Project" (or "HGDP") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies and a helpful visual aid. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2hgdp
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 616 		1658390400 616
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Genome Aggregation Database" (or "gnomAD") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A click into the gnomAD track gives access to their population and other data. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gnomAD
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 740 		1658390400 740
Description: View of ARID1a gene with "CRISPR Targets" Data track enabled in pack mode. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education.
Author: education
Session Name: crispr_fig3
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 686 		1661673600 686
Description: FGFR2 on the “UCSC Genes” and “NCBI Genes” tracks. FGFR2 is read on the opposite, negative strand, hence the leftward facing intron arrows. Different splicing events produce different isoforms of the gene. Read more about splicing in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2
Genome Assembly: hg19
Creation Date: 2022-02-24
Views: 811 		1645689600 811
Description: SNAPC1 gene shown with the first exon highlighted in orange. Find a story about three reading frames in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig1
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 1112 		1656316800 1112
Description: Peak file 'MCF7_E2-ethl.hpeak.out' comparing E2 and ethl-treated (control) samples.
Author: NSP
Session Name: MCF7_E2-ethl_Peaks_hg18
Genome Assembly: hg18
Creation Date: 2022-06-28
Views: 665 		1656403200 665
Description: A close-up of the first exon in the SNAPC1 gene. In this session, we can see the three different frames and the different amino acid sequences each frame contains. Notice how the frame with the methionine is the only frame read for the gene, as it encodes for the start of the first exon of the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig2
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 895 		1656316800 895
Description: Regions of genome detected in biofluids with at least 1 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_1
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 709 		1655452800 709
Description: Regions of genome detected in biofluids with at least 5 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_5
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 947 		1655452800 947
Description: This session shows the proximity of the LCT gene and two variants within the intron of the nearby MCM6 gene that affect the activity of the LCT gene -- causing persistence of lactase activity into adulthood. People with these variants can digest milk as adults. Without at least one of them, lactose intolerance results. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT_MCM6
Genome Assembly: hg19
Creation Date: 2022-06-03
Views: 708 		1654243200 708
Description: This session highlights a single nucleotide change (G to A) with pathogenic consequences found within FOXP2, a gene associated with human speech and language comprehension. FOXP2's association with speech was discovered through this single nucleotide change first witnessed in the "KE family"; A pedigree in which almost half of the members for the past three generations have developed a speech disorder called verbal dyspraxia. The OMIM track is enabled and has a marker representing the nucleotide change found in the KE family pedigree. This G to A allele change results in a codon that corresponds to a different amino acid, histidine instead of the correct amino arginine (p.R553H), and results in a faulty protein which, as seen in the KE family, causes verbal dyspraxia. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2p.R553H
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 688 		1652601600 688
Description: METTL3 gene zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs right to left. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.)
Author: education
Session Name: hg38_revStrandZoom2
Genome Assembly: hg38
Creation Date: 2022-06-01
Views: 667 		1654070400 667
Description: METTL3 gene view zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs left to right -- which is the reverse complement of the sequence encoding the amino acids. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.) Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandZoom
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 716 		1653984000 716
Description: MYC gene with exons and introns. The direction of the small intron arrows can be seen to go from left to right in the MYC gene, denoting the direction of the gene and signifying that the 5’ end is to the left and 3’ to the right (“top” strand). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_MYC
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 810 		1653984000 810
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess a serine (S) in the highlighted position while the other primates present on the track have an asparagine (N). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig4
Genome Assembly: hg19
Creation Date: 2022-05-29
Views: 642 		1653811200 642
Description: Editing for public
Author: QAtester
Session Name: hg38_highlight_v431_edit
Genome Assembly: hg38
Creation Date: 2022-05-26
Views: 710 		1653552000 710
Description: session
Author: QAtester3
Session Name: hg19_v431
Genome Assembly: hg19
Creation Date: 2022-05-24
Views: 692 		1653379200 692
Description: The PLP1 gene is shown with GTEx track, indicating the tissue specificity of gene expression. Note the high signal is brain tissues (yellow bars). The OMIM Allelic Variants track is expanded to full display mode, showing the phenotypes of variants in different locations in the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_pelizaeus
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 755 		1652601600 755
Description: PLP1 gene and OMIM Allelic Variants track. Different variants result in different disease states (mouseover the OMIM Variants). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_PLP1
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 700 		1652601600 700
Description: Highly conserved region in GRK4 gene. High PhyloP score for first and second nucleotides of codons reflects amino acid conservation through evolutionary time. Third base varies (wobble) because these amino acids have multiple codons -- the third base can be anything is free to diverge through time. PFAM track shows that this is a functionally significant region (protein kinase). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_wobble2
Genome Assembly: hg19
Creation Date: 2022-05-12
Views: 709 		1652342400 709
Description: ChIP-seq, ATAC-seq, and RNA-seq count data from sorted porcine myeloid cells in duplicate.
Author: rcorbett
Session Name: susScr11.1_Myeloid_ChIP_ATAC
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 724 		1651824000 724
Description: Quiz 1.
Author: jschifflin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 368 		1693900800 368
Description: view of gene Rpl14 showing alternative splicing
Author: richardmott
Session Name: rn4.Rpl14
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 391 		1690272000 391
Description: view of gene Slc39a12 showing alternative splicing
Author: richardmott
Session Name: rn4.Slc39a12
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 375 		1690272000 375
Description:
Author: nannanzhao
Session Name: terc-ko
Genome Assembly: mm10
Creation Date: 2022-04-11
Views: 678 		1649664000 678
Description:
Author: davem
Session Name: midterm
Genome Assembly: hg38
Creation Date: 2022-04-06
Views: 678 		1649232000 678
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session also includes the two GTEx tracks, which illustrate frequencies of gene expression in different types of tissue.
Author: education
Session Name: hg19_SORBS1gtex
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 674 		1648972800 674
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session is utilized on the Education page in the "splice variants" document.
Author: education
Session Name: hg19_SORBS1
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 702 		1648972800 702
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess an asparagine (N) in the highlighted position while the other primates present on the track have a threonine (T). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig3
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 640 		1652601600 640
Description: RHO hg19
Author: Chaffikm
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-01-26
Views: 486 		1674720000 486
Description:
Author: ZC
Session Name: ATAC
Genome Assembly: hg38
Creation Date: 2022-03-25
Views: 737 		1648195200 737
Description:
Author: EsterCastillo
Session Name: Paneles_VHIO_bed
Genome Assembly: hg19
Creation Date: 2022-03-25
Views: 692 		1648195200 692
Description: Tracks from GEO GSE22104 Samples: GSM550303 Stat4WTTh1 GSM550304 Stat4KOTh1 GSM550305 H3K4me3WTTh1 GSM550306 H3K4me3 S4KOTh1 GSM550307 H3K27me3WTTh1 GSM550308 H3K27me3 S4KOTh1 content.txt files and bedgraph files
Author: twyss
Session Name: Chip_Stat4_Th1_Wei
Genome Assembly: mm9
Creation Date: 2024-12-13
Views: 23 		1734076800 23
Description: This session shows a short match on the UTR sequence for a gene, acugcugagcugggag. If you click below the black box, into the gene page for TGDS, you can then click an "RNA Structure" link. This will bring you to a section where you can then see for the 5' UTR a "Picture" link and see how this RNA fold structure may arrange.
Author: QAtester
Session Name: RNA_plot
Genome Assembly: hg38
Creation Date: 2022-05-03
Views: 867 		1651564800 867
Description: CHip
Author: xiaopei
Session Name: Chip_seq_B
Genome Assembly: hg38
Creation Date: 2024-07-01
Views: 118 		1719820800 118
Description: Review in this mailing list question, https://groups.google.com/a/soe.ucsc.edu/g/genome/c/y3evkDazY2o/m/0WjoQD63BQAJ, the "How to start from scratch to find tracks" and "How to view data in the region of interest and adjust display" sections and instead of using hg38 go to "GRCm38/mm10" and then use "TF" in the track search step. Set the "JASPAR Transcription Factors" track on mm10 to "pack" and then search "Mef2C" and select "Mef2c (ENSMUST00000198199.4) at chr13:83504034-83663343" from the search results, and then zoom out "1.5x" as well. Next click into the grey box for the "JASPAR Transcription Factors Track Settings" and click the "Schema" link on the far right. By clicking the Schema link you will see the fields for the "Primary Table: jaspar2022" and from this page you can use the Tools menu to arrive at the Table Browser, so this table will be automatically selected for you. Here click the "create" button next to "filter:" and for the "score is" field set it from "ignored" to ">" for greater than and put in a value such as 700 and then click submit. Then put in the "output filename:" field a name like "mm10Jaspar_Mef2c_score700.csv" and be sure that you click the button next to "csv (for excel)" and then click "get output" to download the results. Open the resulting file in Excel.
Author: brianlee
Session Name: Shiaoching
Genome Assembly: mm10
Creation Date: 2022-03-16
Views: 673 		1647417600 673
Description: Mm10 browser session associated with our manuscript "Integration of multimodal data in the developing tooth reveals candidate regulatory loci driving human odontogenic phenotypes", Frontiers in Dental Medicine, 2022
Author: emmawentworth
Session Name: mm10_all_18state
Genome Assembly: mm10
Creation Date: 2022-03-08
Views: 1220 		1646726400 1220
Description:
Author: hy123
Session Name: hg38 heart 1
Genome Assembly: hg38
Creation Date: 2022-03-07
Views: 682 		1646640000 682
Description:
Author: asaenz.13
Session Name: Genomics group 7 - final project
Genome Assembly: hg19
Creation Date: 2022-03-04
Views: 705 		1646380800 705
Description:
Author: YKehayova
Session Name: hg19 ATAC-seq 01.03.22
Genome Assembly: hg19
Creation Date: 2022-03-01
Views: 725 		1646121600 725
Description:
Author: aytyuh
Session Name: new
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 739 		1644998400 739
Description:
Author: JFormosa
Session Name: 2-15-22 Hwk6pt1
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 707 		1644912000 707
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "OMIM" track is enabled and shows common nucleotide variants in the region and provides information regarding the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Clicking into the OMIM track provides access to details hosted there. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2omim
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 656 		1658390400 656
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "dbSNP 150" track is enabled and shows common nucleotide variants in the region. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A smaller rsID number corresponds to an earlier entry, meaning that rs671 is one of the earliest uploaded into NCBIs dbSnp database. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2dbSNP150
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 704 		1658390400 704
Description:
Author: Chilliard
Session Name: hg19 - assignment 5
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 1000 		1644912000 1000
Description:
Author: JFormosa
Session Name: 2-14-22 Hwk 5
Genome Assembly: hg19
Creation Date: 2022-02-14
Views: 690 		1644825600 690
Description: Desiccation-induced inflammation and ocular surface disease is suppressed by terminal state MRC1 conjunctival macrophages.
Author: zhenzuo2
Session Name: MRC1_conjunctival_macrophages
Genome Assembly: mm10
Creation Date: 2024-04-23
Views: 184 		1713859200 184
Description:
Author: himtiffant
Session Name: p1 t1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 935 		1644393600 935
Description:
Author: helenajara10
Session Name: mm10w/ Dock6
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 716 		1644393600 716
Description:
Author: aytyuh
Session Name: task 1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 705 		1644393600 705
Description:
Author: helenajara10
Session Name: mm10w/interaction
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 677 		1644393600 677
Description:
Author: Jcotney
Session Name: TFAP2_Enhancer_KO_Session
Genome Assembly: hg38
Creation Date: 2022-02-08
Views: 796 		1644307200 796
Description:
Author: chunmei1991
Session Name: ChIPseq_peak_profile_Weilab
Genome Assembly: hg19
Creation Date: 2022-02-06
Views: 848 		1644134400 848
Description: Close view of the ARID1a gene with the "CRISPR Targets" data track enabled. Filter is set to 90 to show only the best sites. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: crispr_fig5
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 631 		1661673600 631
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The "dbSNP" track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. The "ClinVar" track confirms rs886040510's pathogenicity with a red box and bead. Clicking onto either of these markings will navigate you to a details page that provides more information. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopclinvar
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 629 		1643875200 629
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The dbSNP track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopgain
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 900 		1643875200 900
Description: This session shows a synonymous variant found on BRCA2, a gene associated with breast cancer. The nucleotide change does result in a changed amino acid. The variant in question is highlighted in turquoise. Two dbSNP tracks are enabled and provide more information about the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2synon
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 706 		1643875200 706
Description: This session shows a frameshift variant (highlighted in turquoise) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. Two dbSNP tracks are enabled and provide more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frameshift
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 654 		1643875200 654
Description: This session shows a frameshift variant (highlighted in turquoise, but looks pale green under the yellow highlight) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. The pale yellow highlight shows this change, AGT being the new codon after the C and T nucleotides (pale green) are deleted. This changes the reading frame from the second frame to the first frame shown on the Base Position track, which is set to full in order to visualize three potential reading frames. The red highlight marks the stop codon of this new reading frame. Therefore, this frameshift variant results in a premature stop codon. The dbSNP track is enabled and provides more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frames
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 647 		1643875200 647
Description: This session shows a missense variant, highlighted in turquoise, found on BRCA2. This single nucleotide variant (SNV) changes the resulting amino acid; The original codon "CAT" codes for histidine while an individual with the variant in question would possess either the codon "CAA" or "CAG", coding for glutamine. This means the resulting polypeptide chain would be impacted. However, ClinVar's data does not label this variant as pathogenic. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2missense
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 658 		1643875200 658
Description: This session shows a portion of BRCA2 (exon 11), a gene associated with breast cancer. Two dbSNP tracks are enabled and mark known variants in the region displayed. Red boxes represent variants that disrupt effective protein production (missense), while green boxes indicate that the variant does not change the resulting amino acid (synonymous). Some of these missense variants have pathogenic consequences, causing breast cancer. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2variants
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 812 		1643875200 812
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: helenajara10
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 1138 		1643875200 1138
Description:
Author: Kaushik
Session Name: PHOX2B
Genome Assembly: hg18
Creation Date: 2022-02-05
Views: 745 		1644048000 745
Description:
Author: pwjeffries
Session Name: hg38Covert
Genome Assembly: hg38
Creation Date: 2022-02-02
Views: 717 		1643788800 717
Description:
Author: katerynamarku
Session Name: Fall19 Yeast test (KM)
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 760 		1643616000 760
Description:
Author: pham4tt
Session Name: Spring20 Yeat Test TM,KM,EL
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 696 		1643616000 696
Description:
Author: tomgo
Session Name: mm10- enhancers
Genome Assembly: mm10
Creation Date: 2022-01-31
Views: 709 		1643616000 709
Description:
Author: jos200a
Session Name: Fall 2022 Yeast Test JEAA
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 711 		1643529600 711
Description:
Author: Cliffford081915
Session Name: Spring2022 Yeast Test(JDC)
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 689 		1643529600 689
Description:
Author: garberla
Session Name: CGEMS yeast LG test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 841 		1643184000 841
Description:
Author: ajaycox
Session Name: CGEMS yeast (AJ) test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 730 		1643184000 730
Description:
Author: espinokb
Session Name: CGEMS yeast KE test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 736 		1643184000 736
Description:
Author: CherryLab
Session Name: Nuclear_EyeBrowser_TrackHub
Genome Assembly: hg38
Creation Date: 2021-11-01
Views: 1128 		1635753600 1128
Description:
Author: aytyuh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 934 		1644393600 934
Description:
Author: YKehayova
Session Name: hg19 SBNO1 project
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 752 		1642665600 752
Description:
Author: Pey.davoodi
Session Name: Optional
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 679 		1644220800 679
Description:
Author: Pey.davoodi
Session Name: 4-genes-workshop
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 725 		1644220800 725
Description:
Author: YKehayova
Session Name: hg19 ATAC peaks COLGALT2 promoter
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 771 		1642579200 771
Description: ChIP, ATAC, and RNA-seq counts for sorted porcine myeloid cells in duplicate, along with H3K27ac and H3K4me3 data from other cell types for comparison.
Author: rcorbett
Session Name: susScr11_Myeloid_ChIP_ATAC_comparison
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 756 		1651824000 756
Description: CAG repeats in the HTT gene. Expansion of the CAG repeats leads to Huntington's disease. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: htt_main
Genome Assembly: hg19
Creation Date: 2022-01-13
Views: 833 		1642060800 833
Description: A session highlighting two single-nucleotide variants found in introns 9 and 13 of the MCM6 gene, located upstream from the LCT gene, that impact whether or not an individual is lactase persistent as an adult. Both the OMIM and GWAS tracks have marked these variants as phenotypically relevant to the appearance of lactase persistence. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 960 		1640419200 960
Description:
Author: dxliucmu
Session Name: hg38_ ChIP with H3K4me1 in HC vs SCZ (one pair))
Genome Assembly: hg38
Creation Date: 2022-01-09
Views: 687 		1641715200 687
Description:
Author: JFormosa
Session Name: Hwk6Pt1
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 674 		1645516800 674
Description: Human CD14+ monocytes bivalent genes identified from ENCSR267NWZ, and ENCSR000ASK respectively for H3K4me3 (GSM1003536) and H3K27me3 (GSM1003564) ChIP-seq data sets.
Author: teetoonet
Session Name: Human CD14+ monocytes bivalent genes
Genome Assembly: hg19
Creation Date: 2023-03-02
Views: 439 		1677744000 439
Description: UCLA 2022 workshop -- custom tracks Alus from dbRIP not in rmsk; CAT gene with two names, some SNPs from 151 missense and intron
Author: Example
Session Name: hg19_snp_CAT_Alus
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 734 		1642665600 734
Description:
Author: ani_davis
Session Name: Spring22 Yeast Test AND
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 727 		1643616000 727
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq6
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 772 		1640419200 772
Description: ATG5 intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 795 		1640246400 795
Description: MAP3K7 intron Author: Mustafi P Session Name: ATAC-seq2 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq2
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 817 		1640246400 817
Description: UVRAG promoter-TSS Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq1
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 856 		1640246400 856
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq PC4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 761 		1640246400 761
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seq5 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq5
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 773 		1640246400 773
Description: YEATS2 intron TSS Author: Mustafi P Session Name: ATAC-seq3 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq3
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 762 		1640246400 762
Description: Close-up view if transition zone between a coding and a non-coding region of the virus. Note the High conservation in the PhyloP track in the protein-coding region. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_pconserv
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 602 		1640160000 602
Description: Ebola virus VP24 gene with PhyloP track showing high conservation in the protein-coding region among 160+ isolates. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_phylop
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 802 		1640160000 802
Description: Ebola virus genome showing vp24 gene region. The PhyloP track shows that the 100+ strains of ebola and Marburg have conservation in the protein-coding region of the gene. Pink color indicates a positive value above the display level in the track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_vp24
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 643 		1640160000 643
Description: Zoomed-in view of ebolavirus L protein showing serine codon in the reference that is different in many islolates distantly related to it (lower part of figure). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_codon
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 638 		1640160000 638
Description: Full genome of the ebola virus showing a blat alignment of the Marburg virus. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_blatsearch
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 627 		1640160000 627
Description: Full genome of ebola virus showing proteins in the top track and conservation among several outbreaks in the lower tracks. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_mainsession
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 675 		1640160000 675
Description: Visualization of the BRCA1 Gene, CpG islands and DNA methylations in different cell lines using the bisulfite Seq and Methyl 450k method.
Author: art_03m
Session Name: hg19: Methylation & CpG islands in BRCA1 gene
Genome Assembly: hg19
Creation Date: 2021-12-18
Views: 489 		1639814400 489
Description:
Author: adelaidetovar
Session Name: apoa2
Genome Assembly: hg38
Creation Date: 2021-12-13
Views: 694 		1639382400 694
Description:
Author: SKellaway
Session Name: dnFOSforSNPs
Genome Assembly: hg38
Creation Date: 2021-12-08
Views: 735 		1638950400 735
Description:
Author: Schne2lk
Session Name: hg38 NRL multiomics
Genome Assembly: hg38
Creation Date: 2021-12-07
Views: 736 		1638864000 736
Description:
Author: marielgr
Session Name: ACSS2_ChIPseq
Genome Assembly: mm39
Creation Date: 2021-12-17
Views: 677 		1639728000 677
Description: Aging MapR data in photoreceptor neurons. Loaded bigwig track correspond to the averaged signal for each aging time point generated from three independent biological replicates
Author: juanjaureguilozano
Session Name: dm6_agingMapR
Genome Assembly: dm6
Creation Date: 2021-12-01
Views: 9414 		1638345600 9414
Description: A pipeline for predicting cardiac gene network components using cis-regulatory elements (CREs) Manuscript: Hieu T. Nim*, Louis Dang*, Harshini Thiyagarajah*, Daniel Bakopoulos, Michael See, Natalie Charitakis, Tennille Sibbritt, Michael P. Eichenlaub, Stuart K. Archer, Nicolas Fossat, Richard E. Burke, Patrick P. L. Tam, Coral G. Warr‡, Travis K. Johnson‡#, Mirana Ramialison‡#. "Predicting genes essential for heart development irrespective of their spatial expression pattern". Genome Biology (in press). (*: co-first authors; ‡: co-senior authors; #: corresponding authors)
Author: nimt0001
Session Name: CardiacNetworkComponentPredictor
Genome Assembly: mm9
Creation Date: 2021-11-30
Views: 942 		1638259200 942
Description:
Author: latimeaa
Session Name: Hg38 HISAT2 Retina tracks
Genome Assembly: hg38
Creation Date: 2021-11-30
Views: 766 		1638259200 766
Description:
Author: Eldar
Session Name: SNV
Genome Assembly: hg38
Creation Date: 2021-02-16
Views: 1102 		1613462400 1102
Description:
Author: Eldar
Session Name: CNV
Genome Assembly: hg38
Creation Date: 2021-02-25
Views: 1285 		1614240000 1285
Description:
Author: aigul
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-18
Views: 798 		1637222400 798
Description:
Author: Wen-Cheng
Session Name: Liver_APOA5p
Genome Assembly: hg19
Creation Date: 2020-11-04
Views: 1401 		1604476800 1401
Description:
Author: zunpengliu66
Session Name: WT H3K9me3 ChIP-seq
Genome Assembly: hg38
Creation Date: 2021-11-11
Views: 698 		1636617600 698
Description:
Author: randa2jl
Session Name: Human retina multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 724 		1637049600 724
Description:
Author: young_researcher
Session Name: hg19_intersection
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 1033 		1636272000 1033
Description:
Author: young_researcher
Session Name: hg19_H3F3A
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 875 		1636272000 875
Description:
Author: vladislav
Session Name: intersect_with_DeepZ
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 727 		1636185600 727
Description:
Author: vladislav
Session Name: H3F3A.merge
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 767 		1636185600 767
Description:
Author: vladislav
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 889 		1636185600 889
Description:
Author: megallegos
Session Name: Independent Project Link
Genome Assembly: hg19
Creation Date: 2021-11-05
Views: 1148 		1636099200 1148
Description:
Author: randa2jl
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 760 		1636012800 760
Description:
Author: Schne2lk
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 778 		1636012800 778
Description:
Author: Schne2lk
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1272 		1636012800 1272
Description:
Author: Schne2lk
Session Name: mm9 thrb
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 766 		1636012800 766
Description:
Author: randa2jl
Session Name: wt/nrl CBRs
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1139 		1636012800 1139
Description:
Author: laarne
Session Name: CHIP SEQ ACTUAL SESSION CBR
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 785 		1636012800 785
Description:
Author: Schne2lk
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 791 		1636012800 791
Description:
Author: adityabhagwate
Session Name: bw_upload
Genome Assembly: hg19
Creation Date: 2021-11-03
Views: 799 		1635926400 799
Description:
Author: ashleywilkins
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1214 		1635840000 1214
Description:
Author: sweatbr
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 776 		1635840000 776
Description:
Author: sweatbr
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 967 		1635840000 967
Description:
Author: randa2jl
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1269 		1635840000 1269
Description:
Author: ashleywilkins
Session Name: Cardiomyopathy
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 831 		1635840000 831
Description:
Author: Schne2lk
Session Name: hg19 DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 747 		1635840000 747
Description:
Author: randa2jl
Session Name: hg19-RHO custom track
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 720 		1635840000 720
Description:
Author: Schne2lk
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 789 		1635840000 789
Description:
Author: sweatbr
Session Name: RIDLEY
Genome Assembly: hg38
Creation Date: 2021-11-04
Views: 764 		1636012800 764
Description:
Author: randa2jl
Session Name: Fall21 HTT gene Huntingtons
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 922 		1634630400 922
Description:
Author: Schne2lk
Session Name: hg38 HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 770 		1634630400 770
Description:
Author: whaleycn
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 776 		1634630400 776
Description:
Author: JuliaLaz
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-18
Views: 824 		1634544000 824
Description:
Author: ashleywilkins
Session Name: hg38 HTT GENE
Genome Assembly: hg38
Creation Date: 2021-10-17
Views: 1005 		1634457600 1005
Description:
Author: CherryLab
Session Name: VISIONS_TrackHub
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 886 		1634284800 886
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Parth Doshi
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 27 		1730880000 27
Description:
Author: yoni.arndt
Session Name: ex.1 RAC1
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 803 		1634284800 803
Description:
Author: randa2jl
Session Name: Fall21 HGD gene
Genome Assembly: hg38
Creation Date: 2021-10-14
Views: 749 		1634198400 749
Description:
Author: sweatbr
Session Name: chr3chimp
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 882 		1634025600 882
Description:
Author: randa2jl
Session Name: Fall21 HumanChr2 JennaRandall
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 1018 		1634025600 1018
Description:
Author: JFormosa
Session Name: Hwk6Pt4b
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 672 		1645516800 672
Description:
Author: JFormosa
Session Name: Hwk6Pt4a
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 688 		1645516800 688
Description:
Author: mjliddi16
Session Name: hg19_assignment6
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 1074 		1645516800 1074
Description: BINF6310
Author: Rahulprasad Selvaraj
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-08
Views: 290 		1699430400 290
Description:
Author: tboisjol
Session Name: TB-98358724-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-08
Views: 972 		1633680000 972
Description:
Author: [email protected]
Session Name: RLBase
Genome Assembly: hg38
Creation Date: 2021-10-06
Views: 2176 		1633507200 2176
Description:
Author: [email protected]
Session Name: RLBase_slow
Genome Assembly: hg38
Creation Date: 2021-10-05
Views: 937 		1633420800 937
Description:
Author: kkaczor
Session Name: tamer_hiv_atac
Genome Assembly: hg38
Creation Date: 2021-09-30
Views: 1038 		1632988800 1038
Description:
Author: kkaczor
Session Name: tamer_hiv_rna
Genome Assembly: hg38
Creation Date: 2021-09-29
Views: 987 		1632902400 987
Description:
Author: laarne
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 791 		1634630400 791
Description:
Author: areynolds
Session Name: hg38 HBB-LCR
Genome Assembly: hg38
Creation Date: 2021-09-20
Views: 915 		1632124800 915
Description:
Author: jschlachetzki
Session Name: 20210917_4DBSM_Schlachetzki
Genome Assembly: hg19
Creation Date: 2021-09-17
Views: 739 		1631865600 739
Description:
Author: layla13
Session Name: TSA2R38 Group #4
Genome Assembly: hg19
Creation Date: 2021-09-16
Views: 767 		1631779200 767
Description:
Author: Thijs
Session Name: Wnt_human_NGS_20210914_V2
Genome Assembly: hg38
Creation Date: 2021-09-14
Views: 982 		1631606400 982
Description:
Author: mallorycunningham
Session Name: TASR38 group3
Genome Assembly: hg19
Creation Date: 2021-09-12
Views: 954 		1631433600 954
Description:
Author: noycohen
Session Name: HepG2 and K562 Methylation
Genome Assembly: hg38
Creation Date: 2021-09-12
Views: 1085 		1631433600 1085
Description:
Author: msadams
Session Name: A549
Genome Assembly: hg38
Creation Date: 2021-09-28
Views: 728 		1632816000 728
Description:
Author: xuxing
Session Name: multi-Paired-seq
Genome Assembly: hg38
Creation Date: 2021-10-31
Views: 779 		1635667200 779
Description:
Author: jessicagarth
Session Name: TAS2R38 group4
Genome Assembly: hg19
Creation Date: 2021-09-08
Views: 942 		1631088000 942
Description:
Author: hayes22
Session Name: Fall21 Yeast Test JEH
Genome Assembly: sacCer3
Creation Date: 2021-09-08
Views: 944 		1631088000 944
Description:
Author: SamanthaBusch
Session Name: Fall21 Yeast test SIB
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 993 		1631001600 993
Description:
Author: Siddeldj
Session Name: Fall19 yeast test DJS
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 969 		1631001600 969
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 983 		1631001600 983
Description:
Author: Albert Cheng
Session Name: hg38_Cas9_1_0_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 910 		1631001600 910
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 960 		1631001600 960
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1215 		1631001600 1215
Description:
Author: JuliaLaz
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-07
Views: 1115 		1631001600 1115
Description:
Author: AbigailLambert
Session Name: Fall19 Yeast test AML
Genome Assembly: sacCer3
Creation Date: 2021-09-12
Views: 899 		1631433600 899
Description:
Author: layla13
Session Name: Fall21 Yeast test LA
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 948 		1630828800 948
Description:
Author: gucascau
Session Name: H3-3-2
Genome Assembly: mm10
Creation Date: 2021-09-03
Views: 943 		1630656000 943
Description:
Author: mallorycunningham
Session Name: Fall21 Yeast Test MC
Genome Assembly: sacCer3
Creation Date: 2021-09-03
Views: 953 		1630656000 953
Description:
Author: jessicagarth
Session Name: CGEMS yeast JMG test
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 945 		1630569600 945
Description:
Author: JuliaLaz
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 722 		1630569600 722
Description:
Author: latimeaa
Session Name: CGEMS Worm AAL test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 890 		1630569600 890
Description:
Author: latimeaa
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 775 		1630569600 775
Description:
Author: aazari99
Session Name: CGEMS Worm AA Test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1014 		1630569600 1014
Description:
Author: aazari99
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 759 		1630569600 759
Description:
Author: Schne2lk
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 733 		1630569600 733
Description:
Author: laarne
Session Name: CGEMS worm LAN test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 927 		1630569600 927
Description:
Author: whaleycn
Session Name: Fall21 Mouse Test Group(6)
Genome Assembly: mm9
Creation Date: 2021-09-02
Views: 919 		1630569600 919
Description:
Author: ashleywilkins
Session Name: Fall21 Worm test group #4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 790 		1630569600 790
Description:
Author: randa2jl
Session Name: Fall21 Yeast Test Group 1
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 898 		1630569600 898
Description:
Author: asinerbc
Session Name: FAll21 Yeast test group 2
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 939 		1630569600 939
Description:
Author: AHRImmunity
Session Name: stockingerg_ATACSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1014 		1630483200 1014
Description:
Author: AHRImmunity
Session Name: stockingerg_CHIPSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1106 		1630483200 1106
Description:
Author: Eldar
Session Name: gene level
Genome Assembly: hg38
Creation Date: 2021-08-27
Views: 971 		1630051200 971
Description:
Author: aytyuh
Session Name: newnew
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 706 		1644998400 706
Description:
Author: ssdhar
Session Name: hg19 Pim1 Bc
Genome Assembly: hg19
Creation Date: 2021-08-25
Views: 1026 		1629878400 1026
Description:
Author: zxtzhangqian
Session Name: Lamprey_WGBS
Genome Assembly: petMar3
Creation Date: 2021-08-25
Views: 958 		1629878400 958
Description:
Author: schmi4am
Session Name: Fall19 Yeast test AMS
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 939 		1630828800 939
Description:
Author: ssdhar
Session Name: hg19 mmp11 bc
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 964 		1629187200 964
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac six1
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 935 		1629187200 935
Description:
Author: lyj
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-08-15
Views: 927 		1629014400 927
Description:
Author: lyj
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-15
Views: 1183 		1629014400 1183
Description: H3K27ac ChIP-seq count data from A375 melanoma in response to medium-chain fatty acid (octanoate) administration.
Author: thuang316
Session Name: H3K27ac_ChIP_seq_octanoate
Genome Assembly: hg38
Creation Date: 2021-08-15
Views: 721 		1629014400 721
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2022
Genome Assembly: hg38
Creation Date: 2021-08-11
Views: 3340 		1628668800 3340
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_mm10_ReMap2022
Genome Assembly: mm10
Creation Date: 2021-08-11
Views: 2002 		1628668800 2002
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_dm6_ReMap2022
Genome Assembly: dm6
Creation Date: 2021-08-11
Views: 1290 		1628668800 1290
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_araTha1_ReMap2022
Genome Assembly: hub_2961057_araTha1
Creation Date: 2021-08-11
Views: 2025 		1628668800 2025
Description: This session uses Times font.
Author: brianlee
Session Name: Times_Font
Genome Assembly: hg38
Creation Date: 2021-08-10
Views: 3243 		1628582400 3243
Description: A Public Session using the Avant Guard Font.
Author: brianlee
Session Name: AvantG_Font
Genome Assembly: hg19
Creation Date: 2021-08-10
Views: 2279 		1628582400 2279
Description: 4931406C07Rik Transcripts
Author: szaman2
Session Name: 4931406C07Rik
Genome Assembly: mm10
Creation Date: 2021-08-10
Views: 914 		1628582400 914
Description:
Author: jamesli
Session Name: RNA_ATAC_Cerebellum1
Genome Assembly: mm10
Creation Date: 2021-08-06
Views: 751 		1628236800 751
Description:
Author: gucascau
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-05
Views: 1011 		1628150400 1011
Description: Sessions shows part of spike protein on SARS-CoV-2 genome. One track shows the reference amino acids for the spike protein. A custom track at the top shows the location of two amino acids that are substituted by prolines to hold the protein in the pre-fusion conformation. A track near the bottom shows the Moderna and Pfizer/BioNtech vaccines with the two prolines substituted for lysine and valine of the reference. The last rack shows current variants of concern (VoC). Reconfigure the vaccine track to see the "different RNA bases" by clicking the gray button to the left of track.
Author: Example
Session Name: wuhCor1_ProPro2
Genome Assembly: wuhCor1
Creation Date: 2021-08-04
Views: 982 		1628064000 982
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells alomst exclusively.
Author: EJ
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-03
Views: 1013 		1627977600 1013
Description:
Author: gonzalezvl
Session Name: pha_v1_ncbi
Genome Assembly: hub_2958085_pha_v1_ncbi
Creation Date: 2021-08-02
Views: 1032 		1627891200 1032
Description:
Author: nkfarah
Session Name: snATAC_cerebellum_E12_14
Genome Assembly: mm10
Creation Date: 2021-07-27
Views: 957 		1627372800 957
Description: The gene HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, where as HBD is expressed in red cells almost exclusively.
Author: mw1278
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-31
Views: 916 		1630396800 916
Description: This session has Times font selected and italic styling applied, available from the Genome Browser menu -> Configure page (or "c f" shortcut).
Author: PublicSessions
Session Name: Drosophila Duplication with font
Genome Assembly: dm6
Creation Date: 2021-07-21
Views: 902 		1626854400 902
Description:
Author: jmorlan66
Session Name: PFS_session8
Genome Assembly: hg38
Creation Date: 2021-07-20
Views: 962 		1626768000 962
Description:
Author: Hanson258
Session Name: H3K27me3_myoblast
Genome Assembly: hg38
Creation Date: 2021-07-16
Views: 987 		1626422400 987
Description: chıpseq result
Author: [email protected]
Session Name: hazals.
Genome Assembly: hg38
Creation Date: 2024-06-12
Views: 129 		1718179200 129
Description:
Author: Jinkil_Jeong
Session Name: Shig_Ad
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 977 		1625644800 977
Description:
Author: MatthewMurry
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2021-07-07
Views: 945 		1625644800 945
Description:
Author: smorabito
Session Name: AD_snATAC
Genome Assembly: hg38
Creation Date: 2021-07-07
Views: 1536 		1625644800 1536
Description: Human HOX 11 gene mapped on the positive RLFS readings in the bed file.
Author: arazavi1
Session Name: HOX
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 981 		1625644800 981
Description: This variant affecting Type 1 collagen is identified as a genetic basis for classical EDS and vascular EDS from this source: https://www.ehlers-danlos.com/eds-types/ This session displays SNV clinically oriented annotation tracks at this locus. A paper describing these tracks and the feature that launches them, "Variant Interpretation: UCSC Genome Browser Recommended Track Sets" is in press (pre-print here: https://www.authorea.com/users/423801/articles/529043-variant-interpretation-ucsc-genome-browser-recommended-track-sets)
Author: Kate
Session Name: Ehlers-Danlos Syndrome COL5A1 variant locus (c.934C>T)
Genome Assembly: hg19
Creation Date: 2021-07-08
Views: 1051 		1625731200 1051
Description:
Author: Albert Cheng
Session Name: hg38_JACKIE
Genome Assembly: hg38
Creation Date: 2021-07-01
Views: 973 		1625126400 973
Description:
Author: Albert Cheng
Session Name: mm10_JACKIE
Genome Assembly: mm10
Creation Date: 2021-07-01
Views: 1002 		1625126400 1002
Description: A picture of an assembly hub for Zebu cattle where the current DNA in the region has been sent to the External Tool RSAT Metazoa which discovered a motif, aaacttatagata, within the region. The motif was then highlighted with the Short Match track. The session shows how building assembly hubs enables interoperability with tools beyond the UCSC Genome Browser. To access the External Tools pop-up menu, when browsing a genome hover over the "View" menu and then select External Tools.
Author: PublicSessions
Session Name: ExternalTools
Genome Assembly: hub_2100979_GCF_000247795.1
Creation Date: 2021-07-23
Views: 1121 		1627027200 1121
Description:
Author: ashleywilkins
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 928 		1630915200 928
Description:
Author: Schne2lk
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2021-09-06
Views: 928 		1630915200 928
Description:
Author: artman1967
Session Name: hg19_IBR finale 061521
Genome Assembly: hg19
Creation Date: 2021-06-15
Views: 985 		1623744000 985
Description:
Author: Shevelyov
Session Name: LaminDamID in SpG and SpCs
Genome Assembly: dm3
Creation Date: 2021-06-12
Views: 1058 		1623484800 1058
Description:
Author: PolinaKananykina
Session Name: polina_kananykina
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 950 		1623225600 950
Description:
Author: labashmanov
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1040 		1623225600 1040
Description:
Author: PolinaKananykina
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 949 		1623225600 949
Description:
Author: art591
Session Name: hse21_H3K27ac_MCF-7_human
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 941 		1623225600 941
Description: THRB
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 148 		1712736000 148
Description: PDE6A
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 166 		1712736000 166
Description: RHO edit
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 153 		1712736000 153
Description:
Author: xiaolinwei123
Session Name: hg38_gata6
Genome Assembly: hg38
Creation Date: 2021-05-26
Views: 907 		1622016000 907
Description:
Author: Xenia
Session Name: DNA methilarion 14chr
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 985 		1621843200 985
Description:
Author: gemtang
Session Name: histone
Genome Assembly: hg38
Creation Date: 2021-06-04
Views: 951 		1622793600 951
Description:
Author: Maksimov_Denis
Session Name: RNA_seq
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 1017 		1621843200 1017
Description: Regions on GRCh37 where discordant exome variant calls are enriched when mapped on GRCh38.
Author: mdawood
Session Name: DISCREPS_GRCh37
Genome Assembly: hg19
Creation Date: 2021-05-17
Views: 1223 		1621238400 1223
Description: Regions on GRCh38 where discordant exome variant calls are enriched when mapped on GRCh37.
Author: mdawood
Session Name: DISCREPs_GRCh38
Genome Assembly: hg38
Creation Date: 2021-05-17
Views: 1163 		1621238400 1163
Description:
Author: jojobajo
Session Name: SarkisyanA
Genome Assembly: mm10
Creation Date: 2021-05-17
Views: 1018 		1621238400 1018
Description:
Author: manu90
Session Name: paciente2_trasloca
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 998 		1620806400 998
Description:
Author: manu90
Session Name: ZMIZ
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 1262 		1620806400 1262
Description:
Author: Maksimov_Denis
Session Name: chromatine states
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 1004 		1620720000 1004
Description: tRNA2
Author: ck-j
Session Name: tRNA2
Genome Assembly: hg38
Creation Date: 2022-12-27
Views: 523 		1672128000 523
Description:
Author: eva re
Session Name: mm10_er
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 974 		1620633600 974
Description:
Author: eva re
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 962 		1620633600 962
Description:
Author: jdpachec
Session Name: Pacheco-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-05-01
Views: 979 		1619856000 979
Description:
Author: amatsiev
Session Name: Matsiev-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 998 		1619769600 998
Description:
Author: kailasdhond
Session Name: BME 110 PS 2
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1323 		1619769600 1323
Description:
Author: mbule
Session Name: Bule-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1015 		1619769600 1015
Description:
Author: mai.baker
Session Name: hg38_SAT1_bed
Genome Assembly: hg38
Creation Date: 2021-04-28
Views: 997 		1619596800 997
Description:
Author: beoungle
Session Name: hg19 enhancer and infos
Genome Assembly: hg19
Creation Date: 2021-04-26
Views: 1707 		1619424000 1707
Description:
Author: ramace
Session Name: Mace--PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-25
Views: 933 		1619337600 933
Description:
Author: Maksimov_Denis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 970 		1620720000 970
Description:
Author: abenet
Session Name: HumanMutationFig2
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1028 		1621411200 1028
Description:
Author: abenet
Session Name: HumanMutationFig4
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1006 		1621411200 1006
Description:
Author: gaotc200
Session Name: mockIP_ce11
Genome Assembly: ce11
Creation Date: 2021-04-19
Views: 1072 		1618819200 1072
Description:
Author: gaotc200
Session Name: mockIP_dm6
Genome Assembly: dm6
Creation Date: 2021-04-19
Views: 997 		1618819200 997
Description:
Author: jojshelt
Session Name: ACE 2 04/17/21
Genome Assembly: hg38
Creation Date: 2021-04-17
Views: 989 		1618646400 989
Description:
Author: jojshelt
Session Name: SARS CoV 2 04/15/21
Genome Assembly: wuhCor1
Creation Date: 2021-04-15
Views: 3185 		1618473600 3185
Description:
Author: gatupovmikhail
Session Name: mm10_hw1
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 2700 		1618387200 2700
Description:
Author: Maksimov_Denis
Session Name: bisulfite sequencing
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 996 		1618387200 996
Description: Public session with the basic tracks to identify putative endothelial enhancers, as described in the published method chapter: Neal A, Rodriguez-Caro H, De Val S. Finding and Verifying Enhancers for Endothelial-Expressed Genes. Methods Mol Biol. 2022;2441:351-368. doi: 10.1007/978-1-0716-2059-5_28. PMID: 35099751. If used, please cite the publication. Author: Helena Rodriguez-Caro
Author: HRC
Session Name: AngiogenesisProtocol_2021_DeVal
Genome Assembly: hg19
Creation Date: 2021-04-09
Views: 1042 		1617955200 1042
Description:
Author: qscmki
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2021-04-08
Views: 1099 		1617868800 1099
Description:
Author: gbenegas
Session Name: tabulamuris
Genome Assembly: mm10
Creation Date: 2021-04-06
Views: 1152 		1617696000 1152
Description:
Author: gbenegas
Session Name: primarymotorcortex
Genome Assembly: mm10
Creation Date: 2021-04-06
Views: 1132 		1617696000 1132
Description:
Author: JFormosa
Session Name: Hwk6Pt3
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 668 		1645516800 668
Description: This session shows a heat map display using bigBed tracks. A new bigHeat python program helps build a heat-map style display of tracks in various colors. It takes an input BED file and an expression-matrix and generates one bigBed file per column, colored by the values in the matrix. For SARS-2 there are assays where peptides are spotted onto a microarray and antibodies extracted from blood are run over the array and the bigHeat tool was created to aid in visualizing this microarray type data into a collection of stacked tracks in the Browser seen in this session.
Author: brianlee
Session Name: HeatMap
Genome Assembly: wuhCor1
Creation Date: 2021-04-06
Views: 1002 		1617696000 1002
Description:
Author: ldebiasio
Session Name: DeBiaso-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-27
Views: 967 		1619510400 967
Description:
Author: marijazzz
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-03-28
Views: 1067 		1616918400 1067
Description:
Author: asalisbury1
Session Name: mm9999
Genome Assembly: mm9
Creation Date: 2021-03-25
Views: 1057 		1616659200 1057
Description:
Author: vrlopez
Session Name: Spring 22 Yeast test VL
Genome Assembly: sacCer3
Creation Date: 2022-01-28
Views: 702 		1643356800 702
Description:
Author: Cornelia
Session Name: danRer10_pEGFP-N1_RNA
Genome Assembly: danRer10
Creation Date: 2021-03-04
Views: 1046 		1614844800 1046
Description:
Author: butlertj3
Session Name: sars_cov2_g4_stem-loops
Genome Assembly: wuhCor1
Creation Date: 2020-11-26
Views: 1271 		1606377600 1271
Description: This session shows ChIP-on-ChEP-seq data from Macaca fascicularis testis for H3K27Ac, REC8, RAD21L, SMC1B, STAG3, CTCF, and BORIS/CTCFL. Data in this session are from the PNAS paper: A. Boukaba, J. Liu, C. Ward, Q. Wu1, A. Arnaoutov, J. Liang1, E. M. Pugacheva, M. Dasso, V. Lobanenkov, M. Esteban, and A. V. Strunnikov (2022) Ectopic expression of meiotic cohesin generates chromosome instability in cancer cell line. Proc Natl Acad Sci U S A. Oct 4;119(40):e2204071119. doi: 10.1073/pnas.2204071119.
Author: Strunnik
Session Name: cohesins_CTCF_BORIS_K27Ac_macFas5_pub
Genome Assembly: macFas5
Creation Date: 2021-02-28
Views: 740 		1614499200 740
Description:
Author: jhj981111
Session Name: Pde4b
Genome Assembly: mm10
Creation Date: 2021-03-02
Views: 1034 		1614672000 1034
Description:
Author: Mohamed Hisham
Session Name: hg19-HBB
Genome Assembly: hg19
Creation Date: 2021-03-02
Views: 1004 		1614672000 1004
Description:
Author: veronicaburns
Session Name: mm10_210225
Genome Assembly: mm10
Creation Date: 2021-02-25
Views: 1162 		1614240000 1162
Description:
Author: abenet
Session Name: HumanMutationFig3
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 980 		1621411200 980
Description:
Author: elencampoy
Session Name: HsInv0124
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1159 		1614153600 1159
Description:
Author: elencampoy
Session Name: HsInv1057
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1245 		1614153600 1245
Description:
Author: elencampoy
Session Name: HsInv1051
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1232 		1614153600 1232
Description:
Author: elencampoy
Session Name: HsInv0830
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1003 		1614153600 1003
Description:
Author: elencampoy
Session Name: HsInv0403
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1149 		1614153600 1149
Description:
Author: elencampoy
Session Name: HsInv0397
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1051 		1614153600 1051
Description:
Author: elencampoy
Session Name: HsInv0395
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1005 		1614153600 1005
Description:
Author: elencampoy
Session Name: HsInv0393
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 988 		1614153600 988
Description:
Author: elencampoy
Session Name: HsInv0390
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1044 		1614153600 1044
Description:
Author: elencampoy
Session Name: hsinv0389
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 986 		1614153600 986
Description:
Author: elencampoy
Session Name: HsInv0370
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1034 		1614067200 1034
Description:
Author: elencampoy
Session Name: HsInv1124
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1044 		1614067200 1044
Description:
Author: elencampoy
Session Name: HsInv0290
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1004 		1614067200 1004
Description:
Author: arthurcheng
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-02-20
Views: 1013 		1613808000 1013
Description: Genome-wide profiling of histone H1 variants and H3K9me3 in T47D-MTVL cells upon multiple H1 depletion.
Author: NSP
Session Name: GSE156036_GSE166645
Genome Assembly: hg19
Creation Date: 2020-09-08
Views: 1331 		1599552000 1331
Description:
Author: elencampoy
Session Name: HsInv0786
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1045 		1613635200 1045
Description:
Author: elencampoy
Session Name: HsInv0344
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 994 		1613635200 994
Description:
Author: elencampoy
Session Name: HsInv0340
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1028 		1614067200 1028
Description:
Author: elencampoy
Session Name: HsInv0228
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 993 		1614067200 993
Description:
Author: elencampoy
Session Name: HsInv0396
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1016 		1613548800 1016
Description:
Author: elencampoy
Session Name: hsinv0097
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1030 		1613548800 1030
Description: Posterior Column Ataxia with Retinitis Pigmentosa (PCARP) is a genetic disorder caused by mutations in the FLVCR1 gene that codes for Feline Leukemia Virus Subgroup C Cellular Receptor 1. Mutations in this heme transport protein, can lead to heme toxicity which affects vision and the nervous system. Symptoms begin in childhood and can include Tunnel-like visual loss, night blindness, and photophobia. Through adulthood sensory function decreases, and symptoms of atrophy, loss of touch, and scoliosis, are common. There are four variants of the FLVCR1 gene that cause PCARP. Puffenburger et. al identified a novel variant at position 361 of the FLCR1 gene, an Asparagine-to-Aspartic Acid, missense mutation which is highlighted blue. The Puffenburger variant (blue) is the current focus of the track, if you zoom to see the whole FLVCR gene you will see there are three other variants designated by the OMIM Alleles Track. Two additional variants are also located in exon 1, and a third in exon 8. At position 574 there is a variant resulting in a cysteine-to-arginine missense mutation which is highlighted green, and at position 721, an alanine-to-threonine missense mutation which is highlighted yellow. In Exon 8 at position 1477 there is a variant resulting in a glycine-to-arginine missense mutation. The Clinvar Variants track classifies all four as pathogenic missense mutations. Pathogenic and Likely Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The Conservation track shows that the regions where all four variants are highly conserved across several species. There is no amino acid variation between chimps, dogs, cattle, cattle, mice, fowl, and zebrafish. Conservation across all of these species indicates these regions are important to vertebrates, and explains why these missense mutations are damaging.
Author: jrhemm
Session Name: Juniata Bioinformatics JHNH
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 1049 		1613030400 1049
Description: This session shows bosTau9 for a gene also found in Human_PIK3CG which was described in a PAG 2020 meeting.
Author: brianlee
Session Name: bosTau9_Human_PIK3CG
Genome Assembly: bosTau9
Creation Date: 2021-02-12
Views: 1003 		1613116800 1003
Description:
Author: soniagoozee
Session Name: bushbaby
Genome Assembly: hg38
Creation Date: 2021-02-11
Views: 935 		1613030400 935
Description:
Author: elencampoy
Session Name: inversions
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 992 		1613030400 992
Description:
Author: raceschaeffer
Session Name: mm10_task2_int
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1027 		1612944000 1027
Description:
Author: raceschaeffer
Session Name: mm10_task1
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1395 		1612944000 1395
Description:
Author: joel_mundkl
Session Name: Alg 13 w/ tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1074 		1612944000 1074
Description:
Author: joel_mundkl
Session Name: All 3 tracks session
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1005 		1612944000 1005
Description:
Author: joel_mundkl
Session Name: Gli3 and HH tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1221 		1612944000 1221
Description:
Author: joel_mundkl
Session Name: Gli3 limb binding mm10 (ptch1)
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 999 		1612944000 999
Description:
Author: qhernand
Session Name: Hernandez-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1204 		1619769600 1204
Description:
Author: alecmilazzo
Session Name: mm10_1
Genome Assembly: mm10
Creation Date: 2021-02-09
Views: 1434 		1612857600 1434
Description:
Author: as3838
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1051 		1612771200 1051
Description:
Author: PaoloM1990
Session Name: ACTB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1442 		1612252800 1442
Description:
Author: mdrcetin
Session Name: hg38_encode_bcell_cd34myeloidprogenitor_naturalkiller
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 726 		1637049600 726
Description:
Author: mdrcetin
Session Name: hg38_encode_ucsf4_hyyees64_h1_h9
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 1228 		1637049600 1228
Description:
Author: mdrcetin
Session Name: hg38_k562_encode_minus_strand_only
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 728 		1637049600 728
Description:
Author: molcov
Session Name: Human Duplication
Genome Assembly: hg19
Creation Date: 2021-01-31
Views: 1077 		1612080000 1077
Description: coronavirus spike protein region with some relevant tracks turned on, including variants of concern (VoC).
Author: Example
Session Name: wuhCor1_spike
Genome Assembly: wuhCor1
Creation Date: 2021-01-25
Views: 3328 		1611561600 3328
Description:
Author: Dongyao_Liu
Session Name: mm9_BAML1_and_CLOCK
Genome Assembly: mm9
Creation Date: 2021-04-13
Views: 985 		1618300800 985
Description: The hub shows association of copy number changes of VNTRs (Variable Number Tander Repeat) with local gene expression and CpG methylation in two discovery cohorts ane one replication cohort for which PCR-free Illumina WGS data were available.<br> Read more here: https://gargp01.u.hpc.mssm.edu/ucsc_exp_meth_vntr.html
Author: brianlee
Session Name: VNTR
Genome Assembly: hg19
Creation Date: 2021-01-22
Views: 1045 		1611302400 1045
Description:
Author: elencampoy
Session Name: Hsinv0209
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1030 		1614067200 1030
Description:
Author: elencampoy
Session Name: HsInv0030
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1007 		1614067200 1007
Description:
Author: BOPOHDR
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1461 		1610438400 1461
Description:
Author: ashleywilkins
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 924 		1630915200 924
Description: CAG repeats found in the RUNX2 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig9
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 601 		1660896000 601
Description: Zoom in on CAG repeats found in the gene MED12. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig7
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 617 		1660896000 617
Description: Two different areas of CAG repeats found in the MED12 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig6
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 684 		1660896000 684
Description:
Author: as3838
Session Name: PATRICKDATA
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1085 		1612771200 1085
Description:
Author: AnnaClaireR1
Session Name: mm10_3tracks
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1250 		1612166400 1250
Description:
Author: AnnaClaireR1
Session Name: mm10_testupload
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1095 		1612166400 1095
Description:
Author: PaoloM1990
Session Name: GAPDH_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1058 		1612252800 1058
Description:
Author: PaoloM1990
Session Name: ATP6V0E1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1030 		1612252800 1030
Description:
Author: PaoloM1990
Session Name: GBA_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1101 		1612252800 1101
Description:
Author: PaoloM1990
Session Name: CTSD_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1002 		1612252800 1002
Description:
Author: PaoloM1990
Session Name: CTSB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1134 		1612252800 1134
Description:
Author: PaoloM1990
Session Name: CTSL_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1030 		1612252800 1030
Description:
Author: PaoloM1990
Session Name: MCOLN1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1142 		1612252800 1142
Description:
Author: AnnaClaireR1
Session Name: mm10_smoc
Genome Assembly: mm10
Creation Date: 2021-02-02
Views: 1289 		1612252800 1289
Description: This session helps demonstrate the Simple Tandem Repeats by TRF track. It includes a Short Match track that is simply highlighting the sequence <b>ctctcgct</b> within the window and this reflects how a programmatic approach can annotate the genome, where the Tandem Repeats Finder (TRF) program helps discover and annotate possibly imperfect repeats as well as exact matches. Users who are interested in STRs may want to look at a resource called STRBase https://strbase.nist.gov/index.htm which was founded in 2001 and includes a Variant Allele Reports page for those searching for allele or frequency count information.
Author: brianlee
Session Name: hg38_STR
Genome Assembly: hg38
Creation Date: 2021-01-07
Views: 1352 		1610006400 1352
Description: This session shows an assembly hub on mink that can be loaded with this quick link: https://genome.ucsc.edu/h/GCA_900108605.1<br> The link can also be searched with the position= term: https://genome.ucsc.edu/h/GCA_900108605.1?position=ACE2 <br> It can also have custom data displayed on it, in this case an interact file that can be loaded under My Data and Custom Tracks.
Author: brianlee
Session Name: Mink_hub_interact
Genome Assembly: hub_2637617_GCA_900108605.1
Creation Date: 2021-01-07
Views: 1308 		1610006400 1308
Description:
Author: sarahjc
Session Name: FM GR ChIP Miseq
Genome Assembly: hg38
Creation Date: 2021-01-02
Views: 1212 		1609574400 1212
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV_2
Genome Assembly: hg19
Creation Date: 2020-12-21
Views: 1205 		1608537600 1205
Description:
Author: Libby3121
Session Name: mm39 FoxA2 sites
Genome Assembly: mm39
Creation Date: 2020-12-20
Views: 1171 		1608451200 1171
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV
Genome Assembly: hg19
Creation Date: 2020-12-19
Views: 1638 		1608364800 1638
Description:
Author: solbru
Session Name: hg19_TANGO6
Genome Assembly: hg19
Creation Date: 2020-12-18
Views: 1284 		1608278400 1284
Description:
Author: molcov
Session Name: Drosophila Duplication
Genome Assembly: dm6
Creation Date: 2021-01-30
Views: 1099 		1611993600 1099
Description:
Author: joliemb
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-02-04
Views: 1068 		1612425600 1068
Description:
Author: mongerc
Session Name: mm10BMI1
Genome Assembly: mm10
Creation Date: 2020-12-16
Views: 1245 		1608105600 1245
Description:
Author: rpe13002
Session Name: hg38_CT83_iso3
Genome Assembly: hg38
Creation Date: 2020-12-13
Views: 1375 		1607846400 1375
Description:
Author: rpe13002
Session Name: hg38_TMPRSS4_iso4
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1216 		1607760000 1216
Description:
Author: rpe13002
Session Name: hg38_CT83
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1207 		1607760000 1207
Description:
Author: rpe13002
Session Name: hg38_ADAM9_iso27
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1212 		1607760000 1212
Description:
Author: rpe13002
Session Name: hg38_ITGA6_iso20
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1236 		1607760000 1236
Description:
Author: mongerc
Session Name: Brien2020AllTracks
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1270 		1607328000 1270
Description:
Author: mongerc
Session Name: Brien2020ChIP-RX
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1189 		1607328000 1189
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_multi_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 1782 		1605340800 1782
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_single_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 1579 		1605340800 1579
Description:
Author: sarahjc
Session Name: Nextseq Dedup ESF BAC SS 113020
Genome Assembly: hg38
Creation Date: 2020-11-30
Views: 1217 		1606723200 1217
Description:
Author: ustiugova_al
Session Name: au
Genome Assembly: hg38
Creation Date: 2020-11-27
Views: 1227 		1606464000 1227
Description:
Author: ck-j
Session Name: RNAseq-WT/KO-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-21
Views: 741 		1605945600 741
Description:
Author: ck-j
Session Name: PCPB1-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-17
Views: 768 		1605600000 768
Description: KJ8Vehicle = 0d +TGFB KJ15eEMT = 2d +TGFB KJ12pEMT = 4d +TGFB KJ14Trans = 4d +TGFB followed by 4d TGFB withdrawal KJ11fMET2 = 4d +TGFB followed by 10d TGFB withdrawal KJ9fEMT = 10d +TGFB KJ13pMET = 10d +TGFB followed by 4d TGFB withdrawal KJ10fMET1 = 10d +TGFB followed by 10d TGFB withdrawal
Author: kelsey_johnson1
Session Name: Reversible EMT ATAC-seq peaks
Genome Assembly: hg19
Creation Date: 2020-11-20
Views: 1081 		1605859200 1081
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: RNAseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1277 		1605168000 1277
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: ChIPseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1264 		1605168000 1264
Description:
Author: kkaczor
Session Name: cirm_ucla_2
Genome Assembly: hg38
Creation Date: 2020-11-11
Views: 1288 		1605081600 1288
Description:
Author: jranish
Session Name: Castrillo LXR ChIP
Genome Assembly: mm10
Creation Date: 2020-10-27
Views: 973 		1603785600 973
Description:
Author: zgtman
Session Name: Genescan_3_hg38_SRY
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1437 		1610438400 1437
Description:
Author: manu90
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-11-15
Views: 966 		1605427200 966
Description:
Author: evechen97
Session Name: EC-39545454-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-10
Views: 914 		1633852800 914
Description:
Author: aurbanow
Session Name: tammer
Genome Assembly: mm10
Creation Date: 2020-11-25
Views: 1264 		1606291200 1264
Description:
Author: [email protected]
Session Name: BAC_FOSMID
Genome Assembly: mm9
Creation Date: 2020-10-16
Views: 1480 		1602835200 1480
Description:
Author: psharma
Session Name: 6. PS-75227116-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-06
Views: 1174 		1601971200 1174
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite-2
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 792 		1633593600 792
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 858 		1633593600 858
Description:
Author: fushenchu
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-09-28
Views: 1295 		1601280000 1295
Description:
Author: federikr
Session Name: CRX
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1291 		1601280000 1291
Description: ClinGen tracks show dosage sensitivity (deletion or gains will cause disease or not) of described copy number region (ISCA) and single genes in the region and curation of association of diseases to the genes in these region.
Author: abenet
Session Name: clinical-ClinGenCuration
Genome Assembly: hg19
Creation Date: 2020-09-25
Views: 1294 		1601020800 1294
Description:
Author: zahra jafari
Session Name: homwork
Genome Assembly: hg19
Creation Date: 2021-12-03
Views: 700 		1638518400 700
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "ClinVar" track is enabled and shows common nucleotide variants in the region. Clicking into a rsID provides more information regarding the phenotypic, and possibly pathogenic, consequences of a variant. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2clinvar
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 607 		1658390400 607
Description:
Author: williamhconrad
Session Name: TSS-evaluation
Genome Assembly: hg19
Creation Date: 2020-09-21
Views: 1669 		1600675200 1669
Description:
Author: kianayaghoobian
Session Name: TAS2R38 UniProt
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1270 		1600588800 1270
Description:
Author: kianayaghoobian
Session Name: TAS2R38 group1
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1635 		1600588800 1635
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH_1
Genome Assembly: hg19
Creation Date: 2020-09-14
Views: 1342 		1600070400 1342
Description:
Author: manu90
Session Name: TAD!!
Genome Assembly: hg19
Creation Date: 2021-06-03
Views: 961 		1622707200 961
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH
Genome Assembly: hg19
Creation Date: 2020-09-12
Views: 1330 		1599897600 1330
Description:
Author: zgtman
Session Name: OTOA
Genome Assembly: hg38
Creation Date: 2021-10-11
Views: 895 		1633939200 895
Description:
Author: rstarks23
Session Name: e9.5Placenta_HistoneModification
Genome Assembly: mm10
Creation Date: 2020-09-09
Views: 1271 		1599638400 1271
Description:
Author: AMOza
Session Name: LMM_Conservation
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 1353 		1599638400 1353
Description:
Author: maddieevans9
Session Name: TAS2R38 group(ME,BZ,CB)
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 1998 		1599638400 1998
Description:
Author: gage2ea
Session Name: Fall20 Worm test group 3
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1343 		1599552000 1343
Description:
Author: sconyejekwe
Session Name: Fall20 Mouse test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1073 		1599552000 1073
Description:
Author: calvinc98
Session Name: Fall20 Mouse test group 6
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1276 		1599552000 1276
Description:
Author: occamslaser
Session Name: Fall20 Worm test group# 4
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1082 		1599552000 1082
Description:
Author: hrbaylous
Session Name: Fall20 yeast test group 1
Genome Assembly: sacCer3
Creation Date: 2020-09-08
Views: 1417 		1599552000 1417
Description:
Author: Haley Yandrasitz
Session Name: Fall20 Mouse Test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1226 		1599552000 1226
Description:
Author: jzhicks07
Session Name: CGEMS yeast JMH test
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1277 		1599465600 1277
Description:
Author: biologyassignment
Session Name: Fall19 Yeast test (ACG)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1343 		1599465600 1343
Description:
Author: ArcherS
Session Name: Fall19 Yeast test A.S.
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1247 		1599465600 1247
Description:
Author: federikr
Session Name: Fall20 TAS2R38 group#3
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1136 		1599465600 1136
Description:
Author: perryts
Session Name: Fall20 Yeast Test (TSP)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1273 		1599465600 1273
Description:
Author: maddieevans9
Session Name: Fall20 Yeast test (ME)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1333 		1599465600 1333
Description:
Author: lauren_soleo
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1298 		1599465600 1298
Description:
Author: brockse
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1283 		1599465600 1283
Description:
Author: Chadtb220
Session Name: Fall19 Yeast test CTB
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1322 		1599465600 1322
Description:
Author: AMOza
Session Name: LMM_Conservation_hg38
Genome Assembly: hg38
Creation Date: 2020-09-09
Views: 6969 		1599638400 6969
Description:
Author: kianayaghoobian
Session Name: Fall19 Yeast test KY
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1494 		1599465600 1494
Description:
Author: KeelynCrossin
Session Name: Fall20 yeast test KGC
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1242 		1599379200 1242
Description:
Author: JFormosa
Session Name: Hwk6Pt2
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 650 		1645516800 650
Description:
Author: embdukes
Session Name: Fall20 Yeast test (EDB)
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1334 		1599379200 1334
Description:
Author: napace
Session Name: Fall19 Yeast test NAP
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1454 		1599379200 1454
Description:
Author: federikr
Session Name: Fall20 Yeast Test KF
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1310 		1599379200 1310
Description:
Author: JRozick147
Session Name: wuhCor1-1
Genome Assembly: wuhCor1
Creation Date: 2020-09-05
Views: 1635 		1599292800 1635
Description:
Author: lauren_soleo
Session Name: Fall20 Yeast test LS
Genome Assembly: sacCer3
Creation Date: 2020-09-04
Views: 1287 		1599206400 1287
Description: This session is of the new ALFA (Allele Frequency Aggregator) variants and allele frequency hub. Results from the Allele Frequency Aggregator (ALFA) project will help users interpret the biological impact of common and rare sequence variants. ALFA's initial release includes analysis of genotype data from ~100K unrestricted dbGaP subjects and provides high-quality allele frequency data now displayed on relevant dbSNP records. Eventually ALFA will analyze more than 1M subjects. The current version is for hg38/GRCh38 with work to include hg19/GRCh37 data. Read more about the ALFA project page here: https://www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa
Author: brianlee
Session Name: ALFA_Trio
Genome Assembly: hg38
Creation Date: 2020-09-03
Views: 1806 		1599120000 1806
Description:
Author: brockse
Session Name: Fall20 Yeast Test SB
Genome Assembly: sacCer3
Creation Date: 2020-08-31
Views: 1442 		1598860800 1442
Description:
Author: Yuanyuan Zhang
Session Name: Mechanism of 5mC controlled Arabidopsis clock pace
Genome Assembly: hub_329263_araTha1
Creation Date: 2021-01-11
Views: 3459 		1610352000 3459
Description:
Author: mongerc
Session Name: mm10Suz12
Genome Assembly: mm10
Creation Date: 2020-08-28
Views: 1310 		1598601600 1310
Description: A stop codon (marked in red) found at the end of the METTL3 gene, indicating the end of translation, which proceeds right to left for this gene. Below, we can observe how conservation decreases dramatically after the Stop codon in the “PhyloP” data track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_stop
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 684 		1642579200 684
Description:
Author: alfordml
Session Name: Spring22 Yeast test MA
Genome Assembly: sacCer3
Creation Date: 2022-01-25
Views: 724 		1643097600 724
Description:
Author: gera912
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-08-11
Views: 1307 		1597132800 1307
Description:
Author: feng xue
Session Name: kdm4c
Genome Assembly: hg17
Creation Date: 2020-08-10
Views: 1583 		1597046400 1583
Description:
Author: shuynhs
Session Name: SH-61951083-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-05
Views: 1281 		1601884800 1281
Description: Session of ASHG 2020 Figure 2. Displays Hi-C track format with custom display options (score normalization, display color, arc display).
Author: Lou
Session Name: ASHG2
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1342 		1601884800 1342
Description: Session of ASHG 2020 Figure 1. Displays Hi-C track format with default settings. Additional tracks include UCSC Genes, ChIP-seq signal track from ENCODE, and GeneHancer clustered interactions.
Author: Lou
Session Name: ASHG1
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1309 		1601884800 1309
Description:
Author: boothc
Session Name: Fish n Chips detailed
Genome Assembly: danRer10
Creation Date: 2020-08-04
Views: 1360 		1596528000 1360
Description:
Author: elencampoy
Session Name: HsInv0573
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1026 		1613635200 1026
Description:
Author: jzhicks07
Session Name: CRX 9.28 JMH
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1286 		1601280000 1286
Description:
Author: simonwang612
Session Name: Ying_ATAC_GSDMD
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1682 		1595491200 1682
Description:
Author: simonwang612
Session Name: Ying_ATACseq_peaks
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1729 		1595491200 1729
Description:
Author: simonwang612
Session Name: atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1445 		1595491200 1445
Description:
Author: simonwang612
Session Name: mm10_atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1296 		1595491200 1296
Description:
Author: Lachlan Coin
Session Name: dRNA
Genome Assembly: hg38
Creation Date: 2020-07-22
Views: 1365 		1595404800 1365
Description: Tracks associated with: Buzzi et al. 2022 Sox8 remodels the cranial ectoderm to generate the ear
Author: alexthiery
Session Name: Sox8_otic_reprogramming
Genome Assembly: galGal6
Creation Date: 2021-03-02
Views: 492 		1614672000 492
Description:
Author: Marie-José
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-28
Views: 1561 		1595923200 1561
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/smad3 new promoters
Genome Assembly: hg19
Creation Date: 2020-07-27
Views: 1384 		1595836800 1384
Description:
Author: Schne2lk
Session Name: hg38 RHO multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 792 		1637049600 792
Description:
Author: ashleywilkins
Session Name: hg38 retinal multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 724 		1637049600 724
Description:
Author: chalie102
Session Name: HDA_ChIP_H3K18ac
Genome Assembly: sacCer3
Creation Date: 2021-02-15
Views: 1422 		1613376000 1422
Description:
Author: [email protected]
Session Name: hg38_NTRK2_blat_probes
Genome Assembly: hg38
Creation Date: 2020-10-12
Views: 1477 		1602489600 1477
Description:
Author: LalehEbr
Session Name: hg19 UCSC workshop assignment
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1687 		1595145600 1687
Description:
Author: fatemeh sadat
Session Name: F
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1713 		1595145600 1713
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/dastjerdi
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 1827 		1594972800 1827
Description:
Author: fatemeh sadat
Session Name: FASc
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1942 		1595145600 1942
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/Smad3 promoter
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 1415 		1594972800 1415
Description: Transcript structures for LncExpDB and LncBook databases
Author: lizhao
Session Name: lncexpdb_UCSC
Genome Assembly: hg38
Creation Date: 2023-09-07
Views: 97958 		1694073600 97958
Description: MetamORF: A repository of unique small Open Reading Frames identified by both experimental and computational approaches for gene-level and meta analyses
Author: schoteau
Session Name: MetamORF (hg38)
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1407 		1594713600 1407
Description:
Author: mongerc
Session Name: Brien2020ChipRX
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1362 		1594281600 1362
Description:
Author: mongerc
Session Name: Brien2020RNASeq
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1431 		1594281600 1431
Description:
Author: mongerc
Session Name: Brien2020ATAC
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1374 		1594281600 1374
Description:
Author: Marie-José
Session Name: hg19_TAD
Genome Assembly: hg19
Creation Date: 2020-07-09
Views: 1734 		1594281600 1734
Description:
Author: Stephanie
Session Name: hg19-OXTR
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1384 		1594195200 1384
Description: RCRN
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RCRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 140 		1712736000 140
Description:
Author: Stephanie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-07-08
Views: 1375 		1594195200 1375
Description:
Author: Chen Chunpeng
Session Name: GBM_STAT
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1322 		1594713600 1322
Description:
Author: Stephanie
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1535 		1594195200 1535
Description:
Author: ranjan99
Session Name: RCas9_HSA_IM
Genome Assembly: mm10
Creation Date: 2020-06-28
Views: 1728 		1593331200 1728
Description:
Author: ustiugova_al
Session Name: cd27
Genome Assembly: hg38
Creation Date: 2020-06-26
Views: 1388 		1593158400 1388
Description:
Author: ccpowell
Session Name: solLy4
Genome Assembly: hub_2266061_solLy4
Creation Date: 2020-06-15
Views: 2099 		1592208000 2099
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1585 		1592467200 1585
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1360 		1592467200 1360
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K36me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1331 		1592467200 1331
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1275 		1592467200 1275
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1423 		1592467200 1423
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, K4me2
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1307 		1592467200 1307
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3Kme1
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1264 		1592467200 1264
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H4me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1348 		1592467200 1348
Description:
Author: jeramiahsmith
Session Name: RNAseq_regen_compil
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-06-17
Views: 1568 		1592380800 1568
Description:
Author: williamhconrad
Session Name: hg19 HCT116 DMR Methylation
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1557 		1591689600 1557
Description:
Author: nickeener
Session Name: SARS-CoV-2 Selection
Genome Assembly: wuhCor1
Creation Date: 2020-06-03
Views: 1396 		1591171200 1396
Description:
Author: [email protected]
Session Name: ce10_OP_CNV
Genome Assembly: ce10
Creation Date: 2020-06-01
Views: 1508 		1590998400 1508
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPI_hg38
Genome Assembly: hg38
Creation Date: 2020-06-01
Views: 1506 		1590998400 1506
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPICARD_hg38
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1595 		1590825600 1595
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_CARD
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1403 		1590825600 1403
Description: Zoomed in on the first exon of the METTL3 gene. If we look at the direction of translation/arrows on the introns, we can see that translation for this gene is going from right to left. Zooming in here, the methionine start codon, colored in green, is observable. Notice how the sequence upstream from the start codon (to the right) is an untranslated region, depicted as a half-height box at the UTR region of the 5’ end. Offscreen to the right is more non-coding RNA (indicated by double white arrows). Only after the start codon does translation actually begin in the right-to-left direction. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_exon1
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 708 		1642579200 708
Description: ChIPmera
Author: CGRoque
Session Name: GouveiaRoque_ChIPmera
Genome Assembly: hg38
Creation Date: 2021-04-22
Views: 520 		1619078400 520
Description:
Author: ccpowell
Session Name: solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-25
Views: 1482 		1590393600 1482
Description:
Author: [email protected]
Session Name: ce10_CNV_10kb_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1502 		1589702400 1502
Description:
Author: [email protected]
Session Name: ce10_CNV_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1457 		1589702400 1457
Description:
Author: m1kss
Session Name: mouse chr16 methylation embryonic
Genome Assembly: mm10
Creation Date: 2020-05-13
Views: 1485 		1589356800 1485
Description:
Author: yael porat
Session Name: myc
Genome Assembly: hg38
Creation Date: 2020-05-10
Views: 1434 		1589097600 1434
Description: RNA plus-sense secondary structure prediction by Rangan et al are displayed. Both MEA secondary structured and MSA conserved sequences are formatted as separate tracks. All instances of "CUAAAC" motifs are annotated (plus-sense purple, negative-sense teal, complement GUUUAG) Yellow highlights represent hypothesized negative or complement interactions. Orange highlights represent non-canonical template switching overlapping with regions with high confidence secondary structure predictions. Blue highlights represent canonical TRS-L TRS-B template switching.
Author: jssim
Session Name: wuhCor
Genome Assembly: wuhCor1
Creation Date: 2020-04-23
Views: 1584 		1587628800 1584
Description:
Author: apacis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-05-06
Views: 1900 		1588752000 1900
Description:
Author: Annaneed
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-07-06
Views: 1376 		1594022400 1376
Description:
Author: tsvid
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 896 		1632729600 896
Description:
Author: aoludipe
Session Name: hg19_kishimoto 1998
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 1216 		1632729600 1216
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Difference in tracks results from strictness of parameterisations (Allelic PValue, read coverage) used when calling SNPs.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele union
Genome Assembly: wuhCor1
Creation Date: 2020-04-26
Views: 1590 		1587888000 1590
Description:
Author: tmitchell1
Session Name: SNCG with EXON2 CT and CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1413 		1586937600 1413
Description:
Author: tmitchell1
Session Name: SNCB CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1781 		1586937600 1781
Description:
Author: tmitchell1
Session Name: SNCG CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1527 		1586937600 1527
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac Her3
Genome Assembly: hg19
Creation Date: 2021-08-16
Views: 1038 		1629100800 1038
Description:
Author: kianayaghoobian
Session Name: CRISPR
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1264 		1601280000 1264
Description:
Author: tmitchell
Session Name: WT and mutant on CFTR
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1540 		1585900800 1540
Description:
Author: tmitchell
Session Name: WT and Mutant on Guca1b
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1372 		1585900800 1372
Description:
Author: tmitchell
Session Name: WT and mutant on Guca1a
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1544 		1585900800 1544
Description:
Author: tmitchell
Session Name: WT and Mutant CRX
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1414 		1585900800 1414
Description:
Author: tmitchell
Session Name: MAPT mutation custom track
Genome Assembly: hg38
Creation Date: 2020-04-03
Views: 1416 		1585900800 1416
Description:
Author: tmitchell
Session Name: Exonic seq Custom Track
Genome Assembly: hg19
Creation Date: 2020-04-03
Views: 1424 		1585900800 1424
Description:
Author: liaohy
Session Name: RNAseq_Xia.L_Control_Cex
Genome Assembly: hg19
Creation Date: 2020-04-01
Views: 1480 		1585728000 1480
Description:
Author: liaohy
Session Name: RNAseq_Lin.XT_AM20191204
Genome Assembly: hg38
Creation Date: 2020-04-01
Views: 1503 		1585728000 1503
Description:
Author: Genomedx
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-04-09
Views: 1821 		1586419200 1821
Description:
Author: tmitchell
Session Name: WT and Mutant Arr3
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1408 		1585900800 1408
Description:
Author: andre2tj
Session Name: 3/31_Lab_Assignment_1
Genome Assembly: hg19
Creation Date: 2020-03-31
Views: 1632 		1585641600 1632
Description:
Author: liaohy
Session Name: RNAseq_Lian.JB_AM20200311-01
Genome Assembly: hg38
Creation Date: 2020-03-30
Views: 1463 		1585555200 1463
Description:
Author: sajjeev
Session Name: ICR_CMYC_optimization_03262020
Genome Assembly: hg19
Creation Date: 2020-03-26
Views: 1595 		1585209600 1595
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_RNAseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 622 		1585123200 622
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part2
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 632 		1585123200 632
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 647 		1585123200 647
Description:
Author: ChPreuss
Session Name: MODEL_AD_NONCODING_VARIANTS_PRIORITIZATION
Genome Assembly: hg19
Creation Date: 2020-03-24
Views: 1584 		1585036800 1584
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis of Human and Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_hg38
Genome Assembly: hg38
Creation Date: 2019-08-28
Views: 4307 		1566979200 4307
Description: METTL3 gene on human assembly hg38, showing a gene transcribed from the negative, or lower strand. You can see the exon numbering if you mouse over the exons on either end of the gene. The 5-end of the gene is on the right. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandGene
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 678 		1653984000 678
Description:
Author: fengtao-cau
Session Name: susScr11
Genome Assembly: susScr11
Creation Date: 2020-03-10
Views: 1582 		1583827200 1582
Description:
Author: apodgorny
Session Name: RNA_Seq
Genome Assembly: hg38
Creation Date: 2021-08-04
Views: 1021 		1628064000 1021
Description: “Spliced ESTs” data track set to pack showing varying gene arrangements for the FGFR2 gene. Each EST is labeled with the corresponding tag to the left of its sequence. CN402795 sequence read is missing exon 6 for the FGFR2 gene (yellow highlight). In the orange highlighted region, we can see two more splice variants BE706533 and BE147547 missing exon 7. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2_highlights
Genome Assembly: hg19
Creation Date: 2022-02-28
Views: 666 		1646035200 666
Description:
Author: jeramiahsmith
Session Name: JS_structure_02262020
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-02-26
Views: 1312 		1582704000 1312
Description:
Author: celiagonzalez98
Session Name: Team Work 2
Genome Assembly: hg19
Creation Date: 2020-02-24
Views: 1549 		1582531200 1549
Description:
Author: celiagonzalez98
Session Name: Team Work
Genome Assembly: hg38
Creation Date: 2020-02-24
Views: 1463 		1582531200 1463
Description:
Author: Fu Haifeng
Session Name: Primed VS Naive
Genome Assembly: mm10
Creation Date: 2020-02-21
Views: 1459 		1582272000 1459
Description:
Author: chend8
Session Name: ATAC_150_intergenic_5
Genome Assembly: dm6
Creation Date: 2020-02-19
Views: 1750 		1582099200 1750
Description:
Author: vinayswamy
Session Name: DNTX
Genome Assembly: hg38
Creation Date: 2020-02-17
Views: 1583 		1581926400 1583
Description:
Author: Tamira
Session Name: Mouse ECR
Genome Assembly: hg19
Creation Date: 2020-02-17
Views: 1633 		1581926400 1633
Description:
Author: gaguil17
Session Name: Intersection.
Genome Assembly: mm10
Creation Date: 2020-02-16
Views: 1470 		1581840000 1470
Description:
Author: celiagonzalez98
Session Name: class 4 part 2
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1677 		1581580800 1677
Description:
Author: celiagonzalez98
Session Name: class 4 part 1
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1687 		1581580800 1687
Description:
Author: UxueHuarte
Session Name: my sesion
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1430 		1581580800 1430
Description:
Author: dmr2928
Session Name: Daniel Robertson
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1512 		1581494400 1512
Description:
Author: AdrianFer
Session Name: Intersected_Updated
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1540 		1581494400 1540
Description:
Author: gaguil17
Session Name: Fgf17
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1843 		1581494400 1843
Description:
Author: ManteoAndrade
Session Name: bejeranofoxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1459 		1581494400 1459
Description:
Author: celiagonzalez98
Session Name: class 3 part 2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1465 		1581494400 1465
Description:
Author: celiagonzalez98
Session Name: class 2 enviar
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1678 		1581408000 1678
Description:
Author: mecay.1
Session Name: Session 2 final
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1527 		1581408000 1527
Description:
Author: JonMatas
Session Name: GenoPractice 2 Public
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1656 		1581408000 1656
Description: Juniata Bioinformatics Infantile Parkinsonism – dystonia is the second most popular neurodegenerative disorder. It is followed by Alzheimer. This disease is present in infancy and prevent those affected to live past their teenage year. This disease is fatal and has a second name known as Transporter deficiency Syndrome (DTDS). Those individuals that are affected may have many problem; limb dyskinesia, dystonia, and chorea, (OMIM,1). Currently we do not have an effective treatment to treat Infantile Parkinsonism-dystonia. This genetic mutation shows an increase between HVA and 5-HIAA in the cerebrospinal fluid. This leads to an increase in dopamine to serotonin metabolites, (OMIN,1).
Author: mmendez
Session Name: Juniata Bioinformatics; MM & NP
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1199 		1581321600 1199
Description: Set of publicly available tracks to define enhance regions used in the human left ventricle. Accompanies Gacita et al, 2020.
Author: agacita
Session Name: Gacita_et_al_LV_Enhancer_Tracks
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 2132 		1581321600 2132
Description:
Author: Andy20UNAV
Session Name: SESION2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1732 		1581408000 1732
Description:
Author: irish
Session Name: Example_Diana_gtfassemblyW1_w2
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 2381 		1581321600 2381
Description: Juniata Bioinformatics BMKJ The original encoded protein functions as a transcriptional coactivator that increases c-Myc activity and inhibits transforming growth factor-beta (TGF-beta) and nuclear factor kappa-B (NF-kB) signaling. The encoded protein also regulates the stability of cyclin D1 mRNA and may play a role in cell proliferation and cancer progression. There is only one novel variant of this gene, and it is GLU366GLY. In the Puffenberger paper, they used a tool called PolyPhen-2, which can be found on Harvard's website, said the substitution was "probably damaging" with a score of 0.99. Some common characteristics expressed from the mutation are psychomotor delay, intractable seizures/epilepsy, bulbous nose, wide mouth and tongue, broad jaw, short hands, short tapered fingers, and broad thumbs. The first track pictured below shows a graph that serves as a basis for the predicted alternative splicing transcripts shown in the SIB Genes track. The blocks represent exons and the lines indicate introns. Also, there is a vertex for each splice, start, and end. The graph under the previous track shows the relationship between genetic variation and gene expression in multiple human tissues.
Author: bmiller913
Session Name: SNIP1 BMKJ
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1489 		1581235200 1489
Description: Children with Usher’s syndrome show no problems during infancy but begin to lose their ability to hear and see during childhood. Patients also present with mild lower body abnormalities. Charles Bonnet syndrome may also occur after affected children contract an infectious illness. Charles Bonnet syndrome is characterized by “decreased visual acuity and vivid visual hallucinations.” Usher’s syndrome is caused by a missense mutation on the 454 position of the Histidyl-tRNA synthetase (HARS) gene in which a tyrosine is replaced with an serine. The normal function of HARS is to charge tRNA with a histidine amino acid. Evidence suggests that the mutation that causes Usher’s syndrome may change the recognition of tRNA codons and/or catalytic activity. The Conservation track shows that this region is conserved across several species, and has amino acid variation in two of these species: Zebrafish (M instead of Y) and Lamprey (V instead of Y). Conservation across a number of species suggests that this region is essential to many vertebrates, and is perhaps why a mutation of this region is so detrimental. The CRISPR targets track shows DNA sequences that are targetable by CRISPR RNA guides. This track is able to show an estimate of how efficient the cleavage would be at the site (Green is the highest) as well as how specific the 20-mer primer is to a specific site in the genome (Black is least specific to just that site). This could be helpful when exploring options for gene therapy or modifications to the gene. The ClinVar Variants track shows the positions of variants in the ClinVar database. This track comes with two subtracks: one for long variants (100 bp or more, most of which are copy number variants) and one for short variants (less than 100 bp). The short variant track color codes variants according to their pathogenicity. Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The long variant track color code variants according to whether the variant is a copy number gain or loss. A user can click on a variant to find more information about the variant including a report that contains an interpretation of the variant and peer reviewed citations.
Author: behreka20
Session Name: Juniata Bioinformatics KB, LL, CM
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1506 		1581235200 1506
Description: The tracks in the Synonymous Constraint Public Hub represent regions of protein-coding sequences in which the rate of synonymous substitutions during mammalian evolution has been significantly lower or higher than in the rest of that gene. There are two tracks: Synonymous Constraint Elements (SCEs) have had lower than normal synonymous substitution rates while Synonymous Acceleration Elements (SAEs) have had higher than normal rates. Thanks to Maxim Wolf, Irwin Jungreis and others at MIT for the hub.
Author: PublicSessions
Session Name: SynonymousConstraintHub
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1747 		1581062400 1747
Description: Various mutations of the gene TUBGCP6 lead to alterations in the amino acid sequence of the subsequent protein, which leads to potential loss-of-function of the protein. This presents pathologically with ubiquitous marked microcephaly, a receding forehead, diminutive anterior fontanelle, and sutural ridging, in addition to other varied symptoms such as cognitive impairment, reduced cranial circumference, and epilepsy.
Author: cadeemlet
Session Name: Juniata Bioinformatics CE & SA
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1262 		1581062400 1262
Description: Juniata Bioinformatics SA and CE. Various mutations in gene TUBGCP6 result in microcephaly and chorioretinopathy. This gene codes for a protein that is part of the gamma tubulin complex, which is required for microtubule nucleation at the centrosome, and thus mitosis beginning with interphase. Mutations affecting this protein can lead to symptoms of a receding forehead, diminutive anterior fontanelle, sutural ridging, cognitive delay, visual impairment, diffuse pachygyria, and a hypoplastic cerebellar vermis. SA track: ENCODE Proteogenomics- this track is used to show functional elements of the human genome by using mass spectrometry to determine if translation is occurring by measuring protein produced by transcripts via proteogenomic mapping. This track identifies one exon within the TUBGCP6 gene. It is near the end of the mapped gene and its name is LGAGQTPGELLNPLVLNSVLSK. CE track: GTEx RNA-seq- Displayed also is track for GTEx Gene, which displays the relative gene expression through total mRNA counts of TUBGCP6 in 53 tissue sites distributed throughout the body. What can be derived primarily through this track is that the tissues which exhibit the greatest effects of TUBGCP6 gene mutations also exhibit the highest levels of genetic expression of the gene in healthy individuals, indicating a more prominent role in affected regions.
Author: slca1991
Session Name: Juniata Bioinformatics SA and CE
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1474 		1581062400 1474
Description:
Author: prfreire
Session Name: MOLM13 MEIS1 pull down
Genome Assembly: hg19
Creation Date: 2019-09-11
Views: 920 		1568188800 920
Description:
Author: ignaciogoyache
Session Name: dia5
Genome Assembly: hg38
Creation Date: 2020-02-14
Views: 1736 		1581667200 1736
Description:
Author: Joseph
Session Name: ICH_rat
Genome Assembly: hg38
Creation Date: 2020-02-03
Views: 1459 		1580716800 1459
Description:
Author: philip.tatman
Session Name: sacCer3RepTimingForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1495 		1580457600 1495
Description:
Author: philip.tatman
Session Name: sacCer3CDKByPassForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1434 		1580457600 1434
Description:
Author: dramirez
Session Name: NomLeu3PROseq1st
Genome Assembly: nomLeu3
Creation Date: 2020-04-22
Views: 1565 		1587542400 1565
Description: The nucleosome sequencing data of mouse brain NAC cells from NCBI GEO archive accession GSE54263. The sequence alignment (mm9) coverage profiles (bigWig) of control, stress-susceptible and stress-resilient mice and the nucleosome occupancy change and shift events (BED) are shown.
Author: Erinija
Session Name: mouse NAC nucleosome events (mm9)
Genome Assembly: mm9
Creation Date: 2020-01-27
Views: 1803 		1580112000 1803
Description:
Author: philip.tatman
Session Name: hg38NocReleaseForReview
Genome Assembly: hg38
Creation Date: 2020-01-31
Views: 1408 		1580457600 1408
Description: The disease of interest is Infantile Parkinsonism found on the SLC6A3 gene as the variant IVS9+1G>T. Infantile Parkinsonism is described as is an extremely rare inherited neurological syndrome that presents in early infancy with hypo-kinetic Parkinsonism and dystonia that can lead to fatality. Parkinsonism is a condition that causes movement abnormalities seen in Parkinson's disease such as tremors, slow movement, and impaired speech or muscle stiffness due to he loss of dopamine-containing neurons. Dystonia is a movement disorder in which a person's muscles contract uncontrollably. The SCL6A3 gene provides instruction for making proteins, specifically a dopamine transporter. This protein is found in neurons and is responsible for the transport of dopamine into the cells. Dopamine is a chemical messenger that signals for motivation, behavior, and control movement. The variant changes the first nucleotide of the ninth intron from a G to a T. This mutation would result in a change of the splicing pattern of the DNA. The track that Nicci explored was the CRISPR Targets track which shows the DNA sequences targetable by CRISPR RNA guides using the enzyme Cas9 over the whole human genome. CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily alter DNA sequences and modify gene function. The track shows all potential -NGG target sites across the genome. Gray or black regions indicate impossible or hard to target areas. The colors blue, red, yellow, and green indicate the predicted chance of cleavage from unable to calculate to high predicted cleavage respectively. Mel explored the Vega Genes track which shows gene annotations from the Vertebrate Genome Annotation (Vega) database. Annotations are divided into two sub tracks from the Vega Human Genome Annotation project. The Two sub tracks include Vega protein coding and noncoding gene annotations as well as Vega annotated pseudogenes and immunoglobulin segments. This track follows the display conventions for gene prediction tracks. Transcript type may be found by clicking on the transcript identifier which forms the outside link to the Vega link detail page. School: Juniata College
Author: NMP94876
Session Name: Homewrok 3 Nicole Piccioni and Mell ended Juanita College Bioinformatics
Genome Assembly: hg19
Creation Date: 2020-02-29
Views: 1412 		1582963200 1412
Description:
Author: keconne
Session Name: TAS2R38 group#5
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1293 		1579593600 1293
Description:
Author: nguye5vx
Session Name: Spring 2020 TAS Test VN
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1378 		1579593600 1378
Description:
Author: dschmelt
Session Name: Han_Chinese_LCT_Gene
Genome Assembly: hub_1969921_GCA_002180035.3_HG00514_prelim_3.0
Creation Date: 2020-01-20
Views: 1707 		1579507200 1707
Description:
Author: keough
Session Name: monkey_guides
Genome Assembly: chlSab2
Creation Date: 2020-06-30
Views: 980 		1593504000 980
Description:
Author: Maksimov_Denis
Session Name: ChromHMM_clusters
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 906 		1620720000 906
Description:
Author: swttalyan
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-02-20
Views: 1455 		1582185600 1455
Description:
Author: ilasa.5
Session Name: Day 3 group 5
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1528 		1581494400 1528
Description:
Author: ManteoAndrade
Session Name: foxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1432 		1581494400 1432
Description:
Author: keconne
Session Name: CGEMS yeast KEC test
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1452 		1579075200 1452
Description:
Author: tmitchell
Session Name: Spring 2020 yeast test TM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1422 		1579075200 1422
Description:
Author: marti4sm
Session Name: Fall19 Yeast test SM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1820 		1579075200 1820
Description: This was an example of a CyVerse hosted assembly hub at the PAG 2020 workshop. The data at CyVerse is hosted at this directory that you can click and see the files: <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/">https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/</a>. In that directory you can click and read the text file named <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/hub.txt">hub.txt</a> and see how an assembly hub is a few stanzas that define the names of a genome and where to find binary-indexed raw data to display on the browser. The data is defined by the <code>twoBitPath araTha1.2bit</code> line in the genome stanza and in the <code>bigDataUrl cytoBandIdeo.bigBed</code> and <code>bigDataUrl ensGene.araTha1.bb</code> lines in the track stanzas. There is also an index file on the genes track <code>searchTrix ensGene.araTha1.ix</code> that allows to search the genes by both their names, such as <b> abcc2 </b>and their accessions, such as <b>AT3G50470.1</b>.
Author: brianlee
Session Name: CyVerse_Assembly_Hub
Genome Assembly: hub_1979095_araTha1
Creation Date: 2020-01-13
Views: 1419 		1578902400 1419
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Bridgett vonHoldt from Princeton University. The title of Dr. vonHoldt's talk was <b>Everyone Is Your Friend! the Molecular Architecture of Hypersocial Canines</b>. Dr. vonHoldt analyzed wolf and dog populations and discovered a 5-Mb genomic region on chromosome 6 in dogs previously found to be under positive selection in domestic dog breeding. They gathered data on friendliness between a captive wolf and pet dog populations and then examined variants. The region affected by structural variants associated with the exuberant sociability of domestic dogs related to a gene WBSCR17 on chr7 in humans linked to Williams-Beuren syndrome (WBS), a multisystem congenital disorder characterized by hypersocial behavior. Humans with this mutation have a lack of stranger danger and are overly cheerful. This session shows the WBSCR17 gene in human.
Author: brianlee
Session Name: Human_WBSCR17
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1492 		1578902400 1492
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Claudio V. Mello from Oregon Health and Science University. Dr. Mello's talk was titled <b>What Comparative Studies of Parrot Genomes Can Teach Us about Longevity, Large Brains and Cognition</b>. Dr. Mello identified genomic features under selection in parrots and other long-lived birds that included telomerase activity (TERT), DNA damage repair, control of cell proliferation, cancer, immunity, and anti-oxidative mechanisms. His group also identified many brain-expressed, parrot-specific paralogs with known functions in neural development or vocal-learning brain circuits seen in humans (AUS2). This session shows similar alignment information in the conservation track around human AUTS2 as in one of Dr. Mello’s supplemental slides.
Author: brianlee
Session Name: Human_AUTS2
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1679 		1578902400 1679
Description: This session reflects a PAG 2020 Poster by Hao Meng et al. from Peking-Tsinghua Center for Life Sciences, Peking University. The title of the poster was <b>Morphology and Genetics of Kinked Tails of Domestic Cats (Felis catus) in East and Southeast Asia</b>. Hao Meng and colleagues investigated the morphology and genetics of kinked tails in cats. Mutations in coding sequences (CDS) of T and HES7 were identified correlated to the short tails in Manx and Japanese bobtail breeds as well as some feral cats in Asia, However, about one third of short-tailed cats in China do not carry either variant. The poster described a new 1.6 Mb region with non-synonymous mutations were seen, suggesting changes in regulatory regions, the poster concluded. An example of viewing this region on the UCSC Browser with the regulatory Gene Interactions track turned on. In humans the interactions track seem to suggest this region has many long distant interactions spanning across it from distant enhancers.
Author: brianlee
Session Name: Human_HES7
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1504 		1578902400 1504
Description: This session reflects a PAG 2020 Saturday Session, Cattle/Sheep/Goat 1, and the speaker George E. Liu from the Animal Genomics and Improvement Laboratory, USDA-ARS. The session title was <b>Comparative Epigenomics and Genotype-Phenotype Association Analyses Revealed Conserved Genetic Architecture underlying Complex Traits between Cattle and Human</b>. Dr. Liu’s lab examined comparative genomics around the histone marks and found that they could transfer cell-type-specific information from the human data to infer similar issues about genes related to certain diseases. A specific example was PIK3CG, a gene high specifically expressed in mononuclear cells was significantly associated with both age-at-menopause in human and daugter-still-birth in cattle. This session shows PIK3CG in human.
Author: brianlee
Session Name: Human_PIK3CG
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1553 		1578902400 1553
Description:
Author: ManteoAndrade
Session Name: mi ventana
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1787 		1581408000 1787
Description:
Author: nguye5vx
Session Name: Fall19 Yeast Test VN
Genome Assembly: sacCer3
Creation Date: 2020-01-19
Views: 1574 		1579420800 1574
Description:
Author: agacita
Session Name: enhancer_dominic
Genome Assembly: hg19
Creation Date: 2020-01-03
Views: 1502 		1578038400 1502
Description:
Author: saadiak2
Session Name: MS
Genome Assembly: mm9
Creation Date: 2019-12-19
Views: 1541 		1576742400 1541
Description:
Author: celiagonzalez98
Session Name: class 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1709 		1581408000 1709
Description:
Author: mecay.1
Session Name: session 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1720 		1581408000 1720
Description: ATAC-seq of exocrine epithelial stem cells
Author: woaichixiangcai
Session Name: Exocrine_ATAC
Genome Assembly: mm10
Creation Date: 2024-06-29
Views: 99 		1719648000 99
Description:
Author: katerynamarku
Session Name: TAS2R38
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 632 		1643702400 632
Description:
Author: JonMatas
Session Name: Geno3 G4
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1813 		1581494400 1813
Description:
Author: egrossi
Session Name: Hi-C BAF47
Genome Assembly: hg18
Creation Date: 2019-11-29
Views: 1679 		1575014400 1679
Description: In this specific session of 3 bases with scores missing, at the very end of chrM of mm10, you can see data is lacking from all the related sources (yellow highlight): http://genome.ucsc.edu/s/brianlee/mm10_chrM This explains how there can be a discrepancy between the number of positions covered by the phastCons file and the length of a chromosome. It is likely caused by gaps in the multiple alignment process. Gaps often result from gaps in the reference assembly or variable regions that do not align well between species. Anywhere the multiple alignment is lacking data, phastCons cannot be used to calculated conservation scores.
Author: brianlee
Session Name: mm10_chrM
Genome Assembly: mm10
Creation Date: 2019-11-22
Views: 1926 		1574409600 1926
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1383 		1581321600 1383
Description:
Author: tacazares
Session Name: maxATAC ATAC-seq Data
Genome Assembly: hg38
Creation Date: 2022-04-11
Views: 613 		1649664000 613
Description:
Author: Erinija
Session Name: NA12878 WES Benchmark
Genome Assembly: hg19
Creation Date: 2019-11-28
Views: 2353 		1574928000 2353
Description:
Author: mia_21
Session Name: mitochonrial cyb mutation
Genome Assembly: hg38
Creation Date: 2019-10-31
Views: 1512 		1572508800 1512
Description:
Author: Brigitte
Session Name: snp hla vph
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1478 		1571904000 1478
Description:
Author: cocopow
Session Name: hg38_genes24336
Genome Assembly: hg38
Creation Date: 2019-10-23
Views: 2089 		1571817600 2089
Description:
Author: cocopow
Session Name: hg19_LINC00299
Genome Assembly: hg19
Creation Date: 2019-10-25
Views: 1532 		1571990400 1532
Description:
Author: sguc
Session Name: miR-122_KO_genotyping_primers
Genome Assembly: mm10
Creation Date: 2019-10-17
Views: 1570 		1571299200 1570
Description:
Author: ani_davis
Session Name: TAS2R38 group6
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 621 		1643702400 621
Description:
Author: zhangh357
Session Name: hg19_m6A_site
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1683 		1571040000 1683
Description:
Author: cocopow
Session Name: dm6_transcripts
Genome Assembly: dm6
Creation Date: 2019-10-09
Views: 1532 		1570608000 1532
Description:
Author: ykumar84
Session Name: mm10_CRE
Genome Assembly: mm10
Creation Date: 2019-10-07
Views: 1582 		1570435200 1582
Description:
Author: ykumar84
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 1777 		1570176000 1777
Description:
Author: mecay.1
Session Name: session 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1674 		1581321600 1674
Description:
Author: cocopow
Session Name: hg38_ENCreg
Genome Assembly: hg38
Creation Date: 2019-10-03
Views: 1532 		1570089600 1532
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241C
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1882 		1570003200 1882
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241B
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1712 		1570003200 1712
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241A
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1641 		1570003200 1641
Description:
Author: sallen
Session Name: DSP-hg38
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1461 		1581408000 1461
Description:
Author: rgmilian
Session Name: hg19_BamHIsite
Genome Assembly: hg19
Creation Date: 2019-09-25
Views: 739 		1569398400 739
Description:
Author: rgmilian
Session Name: hg19_20p13_exon_view_flaggedSNPs+exons
Genome Assembly: hg19
Creation Date: 2019-09-24
Views: 601 		1569312000 601
Description:
Author: barloweml
Session Name: YeastPracticeMLB
Genome Assembly: sacCer3
Creation Date: 2019-09-24
Views: 1580 		1569312000 1580
Description:
Author: ykumar84
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-09-18
Views: 1928 		1568793600 1928
Description:
Author: IsaacGelman
Session Name: mm10_h3k4me3
Genome Assembly: mm10
Creation Date: 2019-11-01
Views: 1473 		1572595200 1473
Description:
Author: nheyer
Session Name: New_wiggles
Genome Assembly: hg38
Creation Date: 2019-11-12
Views: 1446 		1573545600 1446
Description: CircRNA annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: hg38 circRNA annotation
Genome Assembly: hg38
Creation Date: 2019-02-10
Views: 1319 		1549785600 1319
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rn5 circRNA annotation
Genome Assembly: rn5
Creation Date: 2016-09-23
Views: 1405 		1474617600 1405
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: mm10 circRNA annotation
Genome Assembly: mm10
Creation Date: 2016-09-23
Views: 1320 		1474617600 1320
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: monDom5 circRNA annotation
Genome Assembly: monDom5
Creation Date: 2016-09-23
Views: 1390 		1474617600 1390
Description:
Author: MarcoDS
Session Name: B_to_PSC_reprogramming
Genome Assembly: mm10
Creation Date: 2019-09-16
Views: 1492 		1568620800 1492
Description:
Author: bethpay
Session Name: mm10_il7r_findenhancerpromoter
Genome Assembly: mm10
Creation Date: 2019-09-09
Views: 1643 		1568016000 1643
Description:
Author: [email protected]
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-09-09
Views: 1362 		1568016000 1362
Screenshot not available
Click Here to view
 Description:
Author: tolvayha
Session Name: Fall18 Worm test HT
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1652 		1535616000 1652
Screenshot not available
Click Here to view
 Description:
Author: tolvayha
Session Name: RHO - Photoreceptor
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1590 		1542096000 1590
Description:
Author: swarnaseetha
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-10-23
Views: 1464 		1571817600 1464
Description: ReMap 2018: An atlas of regulatory regions from an integrative analysis of Human DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info. <a href="https://academic.oup.com/nar/article/46/D1/D267/4602873">ReMap 2018 paper</a>.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2018
Genome Assembly: hg38
Creation Date: 2017-08-11
Views: 3208 		1502438400 3208
Description:
Author: rasou2ba
Session Name: hg19 - rs12357257 - Rasoul
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 1816 		1509436800 1816
Description:
Author: pesinojv
Session Name: TAS2R38 group#4
Genome Assembly: hg19
Creation Date: 2018-01-22
Views: 1680 		1516608000 1680
Description:
Author: oshgo
Session Name: 14q32Methyl450-GO8
Genome Assembly: hg19
Creation Date: 2015-10-19
Views: 1951 		1445241600 1951
Description: GH01J209814 is an enhancer associated with the gene IRF6 (Interferon Regulatory Factor 6). Coding mutations in IRF6 are known to be pathogenic, causing diseases related to cleft lip and cleft palate, such as Van Der Woude Syndrome 1 (VWS1). GH01J209814, an enhancer of IRF6 located ~10kb upstream from the gene, harbors regulatory non-coding variants strongly associated with VWS1.
Author: simonf
Session Name: IRF6 cleft lip enhancer
Genome Assembly: hg19
Creation Date: 2018-11-28
Views: 1690 		1543392000 1690
Description:
Author: australia2018
Session Name: hg18_EP_bamSnps_custom
Genome Assembly: hg18
Creation Date: 2018-11-07
Views: 1665 		1541577600 1665
Description:
Author: [email protected]
Session Name: BAC and FOSMID
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1634 		1553673600 1634
Description:
Author: jazmynperez
Session Name: APP
Genome Assembly: hg19
Creation Date: 2018-11-07
Views: 2306 		1541577600 2306
Description:
Author: huijing
Session Name: check_pacbio
Genome Assembly: dm6
Creation Date: 2018-11-06
Views: 864 		1541491200 864
Description:
Author: cehnouz
Session Name: test1
Genome Assembly: hg19
Creation Date: 2017-08-25
Views: 1791 		1503648000 1791
Description:
Author: jtm
Session Name: shiny_app_hg38_v2
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 2848 		1541404800 2848
Description:
Author: ruhollah
Session Name: 18_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1775 		1541059200 1775
Description:
Author: ruhollah
Session Name: 20_chr1
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1677 		1541059200 1677
Description:
Author: ruhollah
Session Name: 14_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1872 		1541059200 1872
Description:
Author: ruhollah
Session Name: 17_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1697 		1541059200 1697
Description:
Author: ruhollah
Session Name: 19_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1635 		1541059200 1635
Description:
Author: ruhollah
Session Name: 16_chr5
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1638 		1541059200 1638
Description:
Author: ruhollah
Session Name: 6_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1635 		1541059200 1635
Description:
Author: ruhollah
Session Name: 8_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1966 		1541059200 1966
Description:
Author: ruhollah
Session Name: 11_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1623 		1541059200 1623
Description:
Author: ruhollah
Session Name: 12_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1919 		1541059200 1919
Description:
Author: ruhollah
Session Name: 13_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1655 		1541059200 1655
Description:
Author: ruhollah
Session Name: 15_chr19
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1587 		1541059200 1587
Description:
Author: ruhollah
Session Name: 7_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1938 		1541059200 1938
Description:
Author: ruhollah
Session Name: 9_chr20
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1614 		1541059200 1614
Description:
Author: ruhollah
Session Name: 5_chr16
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1713 		1541059200 1713
Description:
Author: ruhollah
Session Name: 4_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1620 		1541059200 1620
Description:
Author: ruhollah
Session Name: 10_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1635 		1541059200 1635
Description:
Author: ruhollah
Session Name: 3_chr14
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1613 		1541059200 1613
Description:
Author: ruhollah
Session Name: 2_chr8
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1752 		1541059200 1752
Description:
Author: ruhollah
Session Name: 1_chr15
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1580 		1541059200 1580
Description: This session highlights data from the DASHR v2.0 Hub, created by the Wang lab at the University of Pennsylvania. DASHR is a comprehensive database of expression and processing information to date on all major classes of human small non-coding RNA (sncRNA) genes and mature sncNA annotations, expression levels, sequence and RNA processing information across 185 human tissues, cell types, and cell lines. The region being visualized shows mir-132. A sncRNA linked to post-transcriptional regulation of neuronal cells. More info on DASHR V2.0: http://dashr2.lisanwanglab.org/
Author: Lou
Session Name: DASHRV2
Genome Assembly: hg38
Creation Date: 2018-12-11
Views: 1910 		1544515200 1910
Description:
Author: sharma.896
Session Name: TP53
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1874 		1540886400 1874
Description: human p53 ChIP-seq coverage depth (tracks) & SISSRs peak calls with associated differential gene expression from published data as of May 2015
Author: cocapo
Session Name: human p53 Binding And Expression Resource (BAER) hub
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1954 		1540886400 1954
Description:
Author: cocopow
Session Name: hg19_rn6_geneHancer
Genome Assembly: hg19
Creation Date: 2019-01-18
Views: 1766 		1547798400 1766
Description:
Author: cocopow
Session Name: hg38_GeneHancer
Genome Assembly: hg38
Creation Date: 2019-01-28
Views: 1661 		1548662400 1661
Description:
Author: apacis
Session Name: Wu_ARMC5_ChIP_C3G
Genome Assembly: mm10
Creation Date: 2020-10-08
Views: 1026 		1602144000 1026
Description: This sessionView is a collection of tracks centered around large genetic variants (CNVs). The session is organized with gene annotations at the top, followed by the <a href="https://academic.oup.com/nar/article/42/D1/D986/1068860" target="_blank">DGV Struct Var track</a>, which displays variants observed in healthy individuals. The rest of the tracks include different databases that visualize large variants linked to disease phenotypes. The region displayed is a 2Mbp region on chr4 with many pathological variants present.
Author: view
Session Name: VariationCNVs
Genome Assembly: hg19
Creation Date: 2018-10-16
Views: 1788 		1539676800 1788
Description: This sessionView is a collection of tracks centered around genetic variation. The collection of tracks primarily displays small variants from multiple databases. The session is organized with tracks having fewer variants with more annotations near the top, and large tracks with fewer annotations near the bottom. The region displayed is the <a href="https://ghr.nlm.nih.gov/gene/SOD1" target="_blank">SOD1 gene</a> which is well annotated and provides an exemplar for this track collection.
Author: view
Session Name: Variation
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1669 		1539158400 1669
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is an ultra-conserved region in the PCBP2 gene where little divergence is seen throughout all mammals. A similar session is available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationDiv" target="_blank">ConservationDiv</a>, which looks at a highly divergent region of the genome.
Author: view
Session Name: ConservationCons
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2610 		1539158400 2610
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is a <a href="https://www.hhmi.org/news/researchers-identify-human-dna-fast-track" target="_blank">human accelerated region (HAR)</a>. HARs are among the most divergent regions in the genome displaying high divergence even among primates. An alternate region of this session is also available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationCons" target="_blank">ConservationCons</a>, which looks at a highly conserved region of the genome.
Author: view
Session Name: ConservationDiv
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2572 		1539158400 2572
Description: This sessionView is a collection of tracks centered around clinical significance. The track composition is similar to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> public session, however, the number of tracks has been reduced to increase clarity. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. The large region, which also includes part of the adjacent GRK4 gene, showcases the more concise view of this track in contrast to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> session. A similar session is also available which shows the bp resolution CAG repeat linked to Huntington's disease, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a>.
Author: view
Session Name: ClinicalLite
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2916 		1539158400 2916
Description: This sessionView is a collection of tracks centered around gene support. The region displayed includes the <a href="https://www.ncbi.nlm.nih.gov/gene /3198" target="_blank"> HOXA1</a> gene and its upstream neighbor <a href="https://www.ncbi.nlm.nih.gov/gene/100506311" target="_blank"> HOTAIRM1</a>. The view is organized with different gene annotation approaches at the top, followed by mRNA evidence, and TSS data at the bottom.
Author: view
Session Name: GeneSupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 2901 		1538726400 2901
Description:
Author: xingjie
Session Name: FMR1-AFF2-iPSC screening
Genome Assembly: hg38
Creation Date: 2018-10-05
Views: 1824 		1538726400 1824
Description:
Author: EsterCastillo
Session Name: VanesaGarcia_AS
Genome Assembly: hg38
Creation Date: 2018-08-14
Views: 1931 		1534233600 1931
Description:
Author: EsterCastillo
Session Name: SandraHernandez_UPF
Genome Assembly: hg38
Creation Date: 2018-12-10
Views: 1553 		1544428800 1553
Description:
Author: EsterCastillo
Session Name: NuriaSala_ICO_AS
Genome Assembly: hg19
Creation Date: 2018-06-18
Views: 1634 		1529308800 1634
Description:
Author: EsterCastillo
Session Name: NRCC_HospTxagorritxo_Guiomar
Genome Assembly: hg19
Creation Date: 2018-08-01
Views: 1660 		1533110400 1660
Description:
Author: EsterCastillo
Session Name: Meme_ROIs_AmpliSeq
Genome Assembly: hg19
Creation Date: 2018-12-18
Views: 1568 		1545120000 1568
Description:
Author: EsterCastillo
Session Name: MarcSorigue
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 2002 		1535097600 2002
Description:
Author: EsterCastillo
Session Name: LifeSequencing_JuanMartinez
Genome Assembly: hg19
Creation Date: 2018-05-18
Views: 1615 		1526630400 1615
Description:
Author: EsterCastillo
Session Name: LauraMuinelo_CHUS_AS
Genome Assembly: hg38
Creation Date: 2018-05-31
Views: 1786 		1527753600 1786
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_25bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 2261 		1553414400 2261
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_10bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 1508 		1553414400 1508
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos_NMs
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1590 		1536220800 1590
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 1562 		1535097600 1562
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Tcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1459 		1559030400 1459
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Bcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1450 		1559030400 1450
Description:
Author: EsterCastillo
Session Name: BarbaraTazon_AS_Myeloid
Genome Assembly: hg19
Creation Date: 2018-04-09
Views: 1673 		1523260800 1673
Description:
Author: EsterCastillo
Session Name: Arnau_DrViladell_AmpliSeq
Genome Assembly: hg19
Creation Date: 2019-05-08
Views: 1413 		1557302400 1413
Description:
Author: EsterCastillo
Session Name: AnaSebio_HospStPau
Genome Assembly: hg19
Creation Date: 2018-05-01
Views: 1804 		1525161600 1804
Description:
Author: EsterCastillo
Session Name: AnaOsorio_AS_CNIO
Genome Assembly: hg19
Creation Date: 2018-05-24
Views: 1678 		1527148800 1678
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge2
Genome Assembly: hg19
Creation Date: 2019-02-11
Views: 1541 		1549872000 1541
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge
Genome Assembly: hg19
Creation Date: 2019-01-31
Views: 1634 		1548921600 1634
Description:
Author: EsterCastillo
Session Name: AmpliSeq Focus
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1587 		1534752000 1587
Description:
Author: EsterCastillo
Session Name: AmpliSeq Cancer HotSpots v2
Genome Assembly: hg19
Creation Date: 2018-06-06
Views: 1562 		1528272000 1562
Description:
Author: EsterCastillo
Session Name: 12Oct_todos37g_DLW
Genome Assembly: hg19
Creation Date: 2019-01-20
Views: 1923 		1547971200 1923
Description:
Author: tzaro
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-10-08
Views: 1897 		1538985600 1897
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq EGFR shjun
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1463 		1547625600 1463
Description:
Author: sajjeev
Session Name: sj39_40
Genome Assembly: hg19
Creation Date: 2019-01-17
Views: 2172 		1547712000 2172
Description:
Author: cocopow
Session Name: mm10_limbs
Genome Assembly: mm10
Creation Date: 2019-01-15
Views: 1771 		1547539200 1771
Description:
Author: emmawentworth
Session Name: Adult-Mouse-Adipose
Genome Assembly: mm10
Creation Date: 2019-04-29
Views: 1566 		1556524800 1566
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 2
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1634 		1538467200 1634
Description:
Author: brittatj
Session Name: Fall19 Yeast test(TB)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1400 		1566892800 1400
Description:
Author: Matteo
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-10-02
Views: 1571 		1538467200 1571
Description:
Author: cocapo
Session Name: dense2pack
Genome Assembly: hg38
Creation Date: 2018-09-26
Views: 1721 		1537948800 1721
Description:
Author: akhoke
Session Name: KMT2E/SRPK2_2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1756 		1537862400 1756
Description:
Author: mazawm
Session Name: hg19#19SingleNucleotideResolution
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1390 		1537862400 1390
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 2 (SNPs)
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1691 		1537862400 1691
Description:
Author: anglemem
Session Name: AMD SNP 2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1705 		1537862400 1705
Description:
Author: akhoke
Session Name: KMT2E/SRPK2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1685 		1537862400 1685
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 1
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1712 		1537862400 1712
Description:
Author: mazawm
Session Name: hg19#19GenomicContext
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1455 		1537862400 1455
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 zoom
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1532 		1537862400 1532
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1585 		1537862400 1585
Description:
Author: Heywhoyou22
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1602 		1537862400 1602
Description:
Author: mazawm
Session Name: hg19HGDmazawm2
Genome Assembly: hg19
Creation Date: 2018-09-19
Views: 1588 		1537344000 1588
Description:
Author: akhoke
Session Name: HGD2
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1593 		1537257600 1593
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise, Exon 10
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1570 		1537257600 1570
Description:
Author: white4cj
Session Name: Fall 19 Yeast Test (JW, PA, MG)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1457 		1566892800 1457
Description:
Author: akhoke
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1595 		1537257600 1595
Description:
Author: mazawm
Session Name: hg19HGDmazawm
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1613 		1537257600 1613
Description:
Author: anglemem
Session Name: HGD Gene (EMA)
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1653 		1537257600 1653
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1554 		1537257600 1554
Description:
Author: yangyangyh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-16
Views: 1594 		1537084800 1594
Description: The LCT gene, responsible for digesting lactose, and the nearby MCM6 gene, which harbors variants that affect the expression of LCT. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCTandMCM6
Genome Assembly: hg19
Creation Date: 2022-06-22
Views: 587 		1655884800 587
Description:
Author: dcaetan2
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-12-05
Views: 1918 		1512460800 1918
Description:
Author: cocopow
Session Name: hg19_chrM
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 2154 		1565683200 2154
Description:
Author: ruifang
Session Name: TAC3
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 1469 		1565510400 1469
Description:
Author: cocopow
Session Name: panTro6_refSeq
Genome Assembly: panTro6
Creation Date: 2019-08-20
Views: 1450 		1566288000 1450
Description:
Author: Alexandra Despang
Session Name: PWD_SNPS_mm10
Genome Assembly: mm10
Creation Date: 2016-01-15
Views: 1431 		1452844800 1431
Description:
Author: mziegler
Session Name: encode_Accessibility _4
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1719 		1536220800 1719
Description:
Author: mziegler
Session Name: encode_Accessibility _3
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1724 		1536220800 1724
Description:
Author: mziegler
Session Name: encode_Accessibility _2
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1719 		1536220800 1719
Description:
Author: mazawm
Session Name: hg19withDSPandMYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1613 		1536048000 1613
Description:
Author: akhoke
Session Name: hg19_9/4/18
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1619 		1536048000 1619
Description:
Author: Heywhoyou22
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1701 		1536048000 1701
Description:
Author: Heywhoyou22
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1599 		1536048000 1599
Description:
Author: zheyangshan
Session Name: hg19 BCL2
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1503 		1536048000 1503
Description:
Author: abby.stapleton
Session Name: Spring17 Mouse Test
Genome Assembly: mm9
Creation Date: 2019-07-29
Views: 1548 		1564387200 1548
Description:
Author: abby.stapleton
Session Name: Spring17 Human Test
Genome Assembly: hg38
Creation Date: 2019-07-29
Views: 1400 		1564387200 1400
Description:
Author: abby.stapleton
Session Name: Spring17 Worm Test
Genome Assembly: ce11
Creation Date: 2019-07-29
Views: 1385 		1564387200 1385
Description:
Author: abby.stapleton
Session Name: Spring17 Yeast Test
Genome Assembly: sacCer3
Creation Date: 2019-07-29
Views: 1415 		1564387200 1415
Description:
Author: jwjiao
Session Name: PRDM16KO1_E15WT1.anno
Genome Assembly: hg38
Creation Date: 2019-08-05
Views: 1384 		1564992000 1384
Description:
Author: xgwZRyfWLidWxULv
Session Name: RPE_public
Genome Assembly: hg19
Creation Date: 2019-01-15
Views: 1468 		1547539200 1468
Description:
Author: elencampoy
Session Name: HsInv0379
Genome Assembly: hg19
Creation Date: 2021-02-25
Views: 908 		1614240000 908
Description:
Author: bondurlc
Session Name: TAS2R38 group 3
Genome Assembly: hg19
Creation Date: 2018-09-03
Views: 1604 		1535961600 1604
Description:
Author: ruhollah
Session Name: hg19_118Chr22_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1559 		1547452800 1559
Description:
Author: ruhollah
Session Name: hg19_100Chr19_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1526 		1547452800 1526
Description:
Author: mazawm
Session Name: mazawm/hg19
Genome Assembly: hg19
Creation Date: 2018-08-31
Views: 1595 		1535702400 1595
Description:
Author: erhuoyi
Session Name: suva
Genome Assembly: hg38
Creation Date: 2018-08-31
Views: 1663 		1535702400 1663
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) Assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 2012 		1535616000 2012
Description:
Author: akhoke
Session Name: Human Genome DSP
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1582 		1535616000 1582
Description:
Author: anglemem
Session Name: EmilyAnglemyer 8/30 In class browser assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1605 		1535616000 1605
Description:
Author: Morgan_T
Session Name: Aug30 Asignment MT
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1602 		1535616000 1602
Description:
Author: stjacqrm
Session Name: Spring18_DSP_RMSJ
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1704 		1535616000 1704
Description:
Author: benbeijs
Session Name: CGEMS Worm (JSB) Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1672 		1535616000 1672
Description:
Author: sschuma
Session Name: Fall18 DSP (SS)
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1569 		1535616000 1569
Description:
Author: akhoke
Session Name: Yeast AKH
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1823 		1535616000 1823
Description:
Author: erick.gabriel
Session Name: ICD-1 gene (by Erick)
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1675 		1535616000 1675
Description:
Author: mazawm
Session Name: mazawm8/30
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1720 		1535616000 1720
Description:
Author: akhoke
Session Name: CGEMS yeast AKH test
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1632 		1535616000 1632
Description:
Author: Morgan_T
Session Name: Fall18 Yeast test M.T.
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1595 		1535616000 1595
Description:
Author: foxaa
Session Name: Fall18 Worm test AF
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 2147 		1535616000 2147
Description:
Author: Heywhoyou22
Session Name: Spring18 Worm test MRK
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1592 		1535616000 1592
Description:
Author: stjacqrm
Session Name: Spring18_Yeast_test_RMSJ
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1788 		1535616000 1788
Description:
Author: hammer
Session Name: piranha-eclip_sclip2
Genome Assembly: hg38
Creation Date: 2018-08-30
Views: 1688 		1535616000 1688
Description:
Author: sschuma
Session Name: Fall18 Yeast Test (SS)
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1580 		1535616000 1580
Description:
Author: Heywhoyou22
Session Name: forenke2
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1646 		1543478400 1646
Description:
Author: Heywhoyou22
Session Name: forenke
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1572 		1543478400 1572
Description:
Author: Boonede
Session Name: TAS2R38#6
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1453 		1547452800 1453
Description: RYiu-90010430-MEDG580-UBC-2020
Author: cpddoraemon
Session Name: RYiu-90010430-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2022-10-09
Views: 465 		1665302400 465
Description:
Author: anzelm
Session Name: hg19-hrc3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 1824 		1521446400 1824
Description:
Author: anzelm
Session Name: hg19-180-10-3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 1630 		1521446400 1630
Description:
Author: anglemem
Session Name: MYBPC1 Anglemyer
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1585 		1536048000 1585
Description:
Author: anglemem
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 1899 		1536134400 1899
Description:
Author: anglemem
Session Name: 10/2 custom track assignment
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1811 		1538467200 1811
Description:
Author: allisontaggart
Session Name: hg19_BPs
Genome Assembly: hg19
Creation Date: 2017-01-18
Views: 2045 		1484726400 2045
Description:
Author: alexc
Session Name: CytoSettings
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 1867 		1520928000 1867
Description:
Author: alexaabdelaziz
Session Name: colored_clusters_Alexa_AA
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 1896 		1487923200 1896
Description:
Author: akhoke
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1616 		1536048000 1616
Description:
Author: akhoke
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1632 		1536048000 1632
Description:
Author: akhoke
Session Name: CRLs3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1595 		1542096000 1595
Description:
Author: akhoke
Session Name: CRLs2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1578 		1542096000 1578
Description:
Author: akhoke
Session Name: CRLs
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1577 		1542096000 1577
Description:
Author: akhoke
Session Name: AMD SNP Custom Track
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1618 		1538553600 1618
Description:
Author: airibarren.1
Session Name: Ventana buena + Hubs
Genome Assembly: hg38
Creation Date: 2018-02-06
Views: 1577 		1517904000 1577
Description:
Author: airibarren.1
Session Name: Regulatory elements; epigentic marks
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2079 		1519632000 2079
Description:
Author: airibarren.1
Session Name: Oregano
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1739 		1519632000 1739
Description:
Author: airibarren.1
Session Name: NHLF
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1718 		1519632000 1718
Description:
Author: airibarren.1
Session Name: NHEK
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1691 		1519632000 1691
Description:
Author: airibarren.1
Session Name: K562
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1798 		1519632000 1798
Description:
Author: airibarren.1
Session Name: HUVEC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2050 		1519632000 2050
Description:
Author: airibarren.1
Session Name: HSMM
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1833 		1519632000 1833
Description:
Author: airibarren.1
Session Name: H1-hESC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1944 		1519632000 1944
Description:
Author: airibarren.1
Session Name: Genes and gene expression
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1737 		1519632000 1737
Description:
Author: airibarren.1
Session Name: GM12878
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1724 		1519632000 1724
Description:
Author: airibarren.1
Session Name: Evolution
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1866 		1519632000 1866
Description:
Author: airibarren.1
Session Name: Ensembl segment
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1706 		1519632000 1706
Description:
Author: airibarren.1
Session Name: Ensembl activity
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1724 		1519632000 1724
Description:
Author: airibarren.1
Session Name: ChIp
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1731 		1519632000 1731
Description:
Author: agacita
Session Name: Regulatory_Variants_Heart_333
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 1783 		1526025600 1783
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_labels
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 2118 		1525939200 2118
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_Final
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 1776 		1526025600 1776
Description:
Author: agacita
Session Name: Regulatory_Var_89912022
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 1571 		1525939200 1571
Description:
Author: afanas
Session Name: hg19-H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-11-27
Views: 2049 		1511769600 2049
Description:
Author: gerbermm
Session Name: TAS2R38 Grp6 MG
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1854 		1547452800 1854
Description:
Author: hammer
Session Name: piranha-eclip_sclip
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1638 		1535356800 1638
Description:
Author: hkao
Session Name: SMARCC1 4-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1429 		1562659200 1429
Description:
Author: hammer
Session Name: ablife
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1719 		1535356800 1719
Description: RNA-seq in cell lines were carried out as follows: after MGC803 cells were transfected with siRNA against circMRPS35 or corresponding control in triplicate, total RNA were extracted and cDNA libraries were constructed for rRNA-depleted sample using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina according to the manufacturer’s instructions, and were sequenced on Illumina HiSeq Xten. RPKM method was used to determine the gene expression. The raw data were analyzed according to the DESeq2 method. Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. For gene ontology (GO) analysis, we downloaded the GO annotations from NCBI, UniProt and the Gene Ontology. Fisher’s exact test was applied to identify the significant GO categories and FDR was used to correct the p-values.
Author: jieMM
Session Name: hg38_FINAL
Genome Assembly: hg38
Creation Date: 2019-11-05
Views: 1702 		1572940800 1702
Description:
Author: leonic
Session Name: bing li et al. m6A RIP
Genome Assembly: mm10
Creation Date: 2018-08-21
Views: 1710 		1534838400 1710
Description:
Author: zxtzhangqian
Session Name: 3a-140-IDH
Genome Assembly: mm9
Creation Date: 2018-08-20
Views: 1825 		1534752000 1825
Description:
Author: davis2018
Session Name: hg19_example_asl
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1593 		1534752000 1593
Description:
Author: ruhollah
Session Name: hg19_29ChrX_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1673 		1543219200 1673
Description:
Author: ruhollah
Session Name: hg19_13Chr3_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1518 		1543219200 1518
Description: This session shows how the multi-region tool allows you to swap in alternate sequences into the main sequence, when desired. For example, if you click the "mutli-region" button under the Browser image (or go to the top "View" menu and then select it), you can paste chr5_KI270794v1_alt in the "Show one alternate haplotype, placed on its chromosome, using ID:" box and then also click the " Highlight alternating regions in multi-region view" box and the result is this session.<br> <br> This issue came up when a user was doing PCR and found two results, one on chr5 and one on chr5_KI270794v1_alt and wanted to understand the meaning of the chr5_..._alt PCR hit. On our gateway page for hg38 (http://genome.ucsc.edu/cgi-bin/hgGateway?db=hg38) you will find an Assembly Details section, which will explain how the Genome Reference Consortium (GRC) in building a reference assembly observed several human chromosomal regions exhibit sufficient variability to prevent adequate representation by a single sequence and to address this issue, the GRCh38/hg38 assembly provides alternate sequence for selected variant regions through the inclusion of alternate loci scaffolds (or alt loci). The assembly contains 261 alt loci, where this chr5_KI270794v1_alt is one of the regions that just happens to be right around the specific gene of interest. This GRC Assembly Terminology page is useful in learning the definition of alternate sequences: https://www.ncbi.nlm.nih.gov/grc/help/definitions/ The answer to the user was that in some ways one can interpret this additional chr5_KI270794v1_alt PCR result as a representation where the GRC determined an additional sequence provides an alternate representation of the same locus. And this session helps to visualize that alternate sequence in place around the rest of the chromosome. <img src="https://groups.google.com/a/soe.ucsc.edu/group/genome/attach/d6cb8d335b5b/image.png?part=0.1&authuser=0" alt="PCR results">
Author: brianlee
Session Name: hg38_ chr5_KI270794v1_alt
Genome Assembly: hg38
Creation Date: 2018-08-10
Views: 1628 		1533888000 1628
Description:
Author: chubukovp
Session Name: hg19_SMC_upload
Genome Assembly: hg19
Creation Date: 2016-10-14
Views: 1978 		1476432000 1978
Description:
Author: anglemem
Session Name: CGEMS Worm EA Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1557 		1535616000 1557
Description:
Author: ruhollah
Session Name: hg19_170Chr1_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1500 		1547452800 1500
Description:
Author: ruhollah
Session Name: hg19_173Chr2_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1506 		1547452800 1506
Description: RNA-seq data from Lee HC et al. Open Biol. 2020 Feb. Molecular anatomy of the pre-primitive-streak chick embryo.
Author: stern_lab
Session Name: Lee HC et al. chick pre-primitive streak
Genome Assembly: galGal5
Creation Date: 2020-06-25
Views: 1417 		1593072000 1417
Description:
Author: cocopow
Session Name: hg38_bw_GSM1131536
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1477 		1551945600 1477
Description:
Author: cocopow
Session Name: hg38_HGMDvsCurated
Genome Assembly: hg38
Creation Date: 2019-03-06
Views: 1710 		1551859200 1710
Description:
Author: cocopow
Session Name: danRer11_bw_GSM1131536
Genome Assembly: danRer11
Creation Date: 2019-03-07
Views: 1388 		1551945600 1388
Description:
Author: cocopow
Session Name: mm10_bejTB
Genome Assembly: mm10
Creation Date: 2019-08-01
Views: 1356 		1564646400 1356
Description:
Author: ascendgene
Session Name: 60genes panel chrX
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1601 		1532505600 1601
Description:
Author: ascendgene
Session Name: 60genes panel chr22
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1614 		1532505600 1614
Description:
Author: ascendgene
Session Name: 60genes panel chr17
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1677 		1532505600 1677
Description:
Author: ascendgene
Session Name: 60genes panel chr16
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1575 		1532505600 1575
Description:
Author: ascendgene
Session Name: 60genes panel chr14
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1577 		1532505600 1577
Description:
Author: Gabriel
Session Name: LDTF-Kras
Genome Assembly: mm10
Creation Date: 2020-03-26
Views: 1326 		1585209600 1326
Description:
Author: ascendgene
Session Name: 60genes panel chr18
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1492 		1532505600 1492
Description:
Author: dorothyzhao
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 1380 		1565683200 1380
Description:
Author: ascendgene
Session Name: 60genes panel chr19
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1553 		1532505600 1553
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_Thaliana
Genome Assembly: hub_1936559_araTha1
Creation Date: 2019-08-29
Views: 8382 		1567065600 8382
Description:
Author: ascendgene
Session Name: 60genes panel chr15
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1644 		1532505600 1644
Description:
Author: dantaki
Session Name: sv2_merge_debug
Genome Assembly: hg19
Creation Date: 2018-11-08
Views: 1594 		1541664000 1594
Description:
Author: dantaki
Session Name: ccr_hg19
Genome Assembly: hg19
Creation Date: 2018-12-12
Views: 1636 		1544601600 1636
Description:
Author: ascendgene
Session Name: 60genes panel chr6
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1761 		1532505600 1761
Description:
Author: danrlu
Session Name: Fuller_paper
Genome Assembly: dm6
Creation Date: 2019-10-25
Views: 1863 		1571990400 1863
Description:
Author: mersedehr
Session Name: NSUN4_v2_rs66575205
Genome Assembly: hg19
Creation Date: 2018-06-15
Views: 1577 		1529049600 1577
Description: This sessionView is a collection of tracks centered around epigenomics. The profiles displayed primarily belong to the H1 cell line, however different origin samples may be chosen in the track configurations. The display is organized with gene annotations and mRNA abundance first, followed by regulatory profiles in the form of <a href="https://www.ncbi.nlm.nih.gov/pubmed/21441907" target="_blank">chromatin states (ChromHMM)</a>. These data are followed by ChIP-seq tracks exploring various transcription factors and regulatory regions/promoter tracks looking at DNase/CpG/methylation. The final tracks are the <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx combined eQTL</a>, which identifies genetic variants likely affecting proximal gene expression, and the GTEx Gene Expression, which shows median gene expression levels in 51 tissues and 2 cell lines. The region visualized is a ~12,000bp window surrounding the <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1 gene</a> transcription start site. <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1</a> is a tumor suppressor and housekeeping gene linked to increased susceptibility to breast cancer when <a href="https://www.ncbi.nlm.nih.gov/pubmed/16846527" target="_blank">certain epigenomic markers are present</a>.
Author: view
Session Name: Epigenomics
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1700 		1539158400 1700
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is a 294bp window looking at the CAG repeat linked to Huntington’s disease in the HTT gene. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity, and <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> which is the most informative clinical view.
Author: view
Session Name: ClinicalZoom
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 12898 		1539158400 12898
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, a cancer mutation database and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a> which shows the bp resolution CAG repeat linked to Huntington's disease, as well as <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity.
Author: view
Session Name: Clinical
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 3379 		1539158400 3379
Description: This sessionView is a collection of tracks centered around assembly support. The region displayed includes a reported GRC incident on hg19 which was then patched. It also showcases a gap which can lead to inconsistent or missing data on existing tracks; as seen by the Mappability and 1000 Genomes Project Accessible Regions tracks.
Author: view
Session Name: AssemblySupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 1638 		1538726400 1638
Description:
Author: ascendgene
Session Name: 60genes panel chr13
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1800 		1532505600 1800
Description:
Author: ascendgene
Session Name: 60genes panel chr12
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1632 		1532505600 1632
Description:
Author: ascendgene
Session Name: 60genes panel chr10
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1998 		1532419200 1998
Description:
Author: csitans
Session Name: Mouse ncRNA HSCs
Genome Assembly: mm9
Creation Date: 2017-06-19
Views: 1636 		1497859200 1636
Description:
Author: cschee
Session Name: RNA_HEMa
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1969 		1465891200 1969
Description:
Author: cschee
Session Name: RNA_A375
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1841 		1465891200 1841
Description:
Author: cschee
Session Name: A375_K27me3
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1834 		1465891200 1834
Description:
Author: cschee
Session Name: A375_K27Ac
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 1850 		1465977600 1850
Description:
Author: cschee
Session Name: A375_Input_21092016
Genome Assembly: hg19
Creation Date: 2016-09-21
Views: 1975 		1474444800 1975
Description:
Author: cschee
Session Name: A375_Input
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 1790 		1465977600 1790
Description:
Author: cosmid88
Session Name: SRY-SOX9-ChIP-Chip
Genome Assembly: mm8
Creation Date: 2013-06-29
Views: 2355 		1372492800 2355
Description:
Author: ascendgene
Session Name: 60genes panel chr9
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1547 		1532419200 1547
Description:
Author: cyoung
Session Name: Young, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-09-10
Views: 1600 		1505030400 1600
Description:
Author: cyoung
Session Name: Fall17 Bio630 CY test
Genome Assembly: mm9
Creation Date: 2017-09-13
Views: 1600 		1505289600 1600
Description:
Author: cyoung
Session Name: Bio630 CRX variants Young
Genome Assembly: hg38
Creation Date: 2017-09-26
Views: 1650 		1506412800 1650
Description:
Author: ascendgene
Session Name: 60genes panel chr8
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1581 		1532505600 1581
Description:
Author: ascendgene
Session Name: 60genes panel chr7
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1541 		1532419200 1541
Description:
Author: ascendgene
Session Name: 60genes panel chr5
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1865 		1532419200 1865
Description:
Author: ddunican
Session Name: MBD3 WT v KO medip-seq ion_torrent mm9
Genome Assembly: mm9
Creation Date: 2016-09-26
Views: 2029 		1474876800 2029
Description:
Author: ascendgene
Session Name: 60genes panel chr4
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1715 		1532419200 1715
Description:
Author: ascendgene
Session Name: 60genes panel chr3
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1608 		1532419200 1608
Description:
Author: ascendgene
Session Name: 60genes panel chr2
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2011 		1532419200 2011
Description:
Author: Welekie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-05-20
Views: 1263 		1589961600 1263
Description:
Author: simonwang612
Session Name: worm_ChIP_seq_L4_0716
Genome Assembly: ce10
Creation Date: 2018-07-16
Views: 1632 		1531728000 1632
Description:
Author: olena
Session Name: OTC-regulatory
Genome Assembly: hg19
Creation Date: 2018-07-13
Views: 1788 		1531468800 1788
Description:
Author: jtm
Session Name: shiny_app_mm10_v1
Genome Assembly: mm10
Creation Date: 2018-07-11
Views: 2728 		1531296000 2728
Description:
Author: jtm
Session Name: shiny_app_hg38_v1
Genome Assembly: hg38
Creation Date: 2018-07-11
Views: 4839 		1531296000 4839
Description:
Author: Kyle@Arkell_Lab
Session Name: hg38_ZIC2_3'UTR_RNA_Annotation
Genome Assembly: hg38
Creation Date: 2018-07-10
Views: 1782 		1531209600 1782
Description:
Author: tonyzeng
Session Name: apa
Genome Assembly: hg19
Creation Date: 2018-07-06
Views: 1858 		1530864000 1858
Description:
Author: speese
Session Name: dm6 FlyVar track
Genome Assembly: dm6
Creation Date: 2018-07-05
Views: 1383 		1530777600 1383
Description:
Author: Mouro_81
Session Name: B6J vs 129S1 SNPs at Lrrfip2/Mlh1
Genome Assembly: mm10
Creation Date: 2017-05-15
Views: 1832 		1494835200 1832
Description:
Author: MeganDurham
Session Name: BRAF
Genome Assembly: hg19
Creation Date: 2018-04-24
Views: 1795 		1524556800 1795
Description:
Author: Leif.Benner
Session Name: Leif_session
Genome Assembly: dm3
Creation Date: 2015-04-11
Views: 1784 		1428739200 1784
Description:
Author: Lab252
Session Name: Roche_et_al_NAR_44_19_9315_2016
Genome Assembly: hg19
Creation Date: 2016-07-04
Views: 1928 		1467619200 1928
Description:
Author: Kurotaki
Session Name: mm10 tachibana
Genome Assembly: mm10
Creation Date: 2016-05-12
Views: 1929 		1463040000 1929
Description:
Author: Ketty
Session Name: hg38_ChiPseq CRISPR clones
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1479 		1561017600 1479
Description:
Author: KateLawrensonCSHS
Session Name: OCAC_CIMBA_Oncoarray
Genome Assembly: hg19
Creation Date: 2016-05-03
Views: 2418 		1462262400 2418
Description:
Author: Vizoso1
Session Name: UBP10
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1877 		1500969600 1877
Description:
Author: Vizoso1
Session Name: RSA4
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1960 		1500969600 1960
Description:
Author: Vizoso1
Session Name: NMD3
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1754 		1500969600 1754
Description:
Author: Vizoso1
Session Name: ENP1
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1807 		1500969600 1807
Description:
Author: Tung
Session Name: ndst1_10snp
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 1928 		1523606400 1928
Screenshot not available
Click Here to view
 Description:
Author: Toma Matveeva
Session Name: CGEMS #1
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1898 		1469088000 1898
Screenshot not available
Click Here to view
 Description:
Author: Tao Zhang
Session Name: chicken lncRNA
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-28
Views: 2130 		1480320000 2130
Description:
Author: Robin
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 1875 		1475568000 1875
Description:
Author: Robin
Session Name: CHPv3 versus Sanger/CHPv2
Genome Assembly: hg19
Creation Date: 2016-07-11
Views: 1788 		1468224000 1788
Description:
Author: Rahman.team
Session Name: CART38A
Genome Assembly: hg38
Creation Date: 2018-10-30
Views: 1696 		1540886400 1696
Description:
Author: Rahman.team
Session Name: CART37A
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1722 		1540886400 1722
Description:
Author: cocopow
Session Name: hg38_23676
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1385 		1561017600 1385
Description:
Author: cocopow
Session Name: hg19_superDuperTrack
Genome Assembly: hg19
Creation Date: 2019-04-16
Views: 1680 		1555401600 1680
Description:
Author: cocopow
Session Name: hg19_DMR_chr2
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1434 		1554105600 1434
Description:
Author: cocopow
Session Name: hg19_DMR_1chr1_P180_P21_exm_3
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1425 		1553155200 1425
Description:
Author: cocopow
Session Name: hg19_ChIA
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1458 		1553155200 1458
Description:
Author: cocopow
Session Name: hg19_BedGraph
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1551 		1553846400 1551
Description:
Author: cocopow
Session Name: danRer7_bw_GSM1131536
Genome Assembly: danRer7
Creation Date: 2019-03-07
Views: 1465 		1551945600 1465
Description:
Author: britnyblu
Session Name: rena_atac_data
Genome Assembly: mm10
Creation Date: 2019-08-15
Views: 1394 		1565856000 1394
Description:
Author: megallegos
Session Name: Biol 310: Module 2 TSS-seq
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 4842 		1536048000 4842
Description:
Author: mjulialamberti
Session Name: cxcl12
Genome Assembly: hg38
Creation Date: 2019-08-08
Views: 1393 		1565251200 1393
Description:
Author: [email protected]
Session Name: mm10 Linnarsson Celltype autoscale
Genome Assembly: mm10
Creation Date: 2019-02-18
Views: 759 		1550476800 759
Description:
Author: masuping
Session Name: chr_lncRNA-seq_CPM
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1345 		1571040000 1345
Description: Sept 10, 2024
Author: rchelsea
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-11
Views: 45 		1726041600 45
Description:
Author: sajjeev
Session Name: foxa1_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1394 		1563782400 1394
Screenshot not available
Click Here to view
 Description:
Author: sajjeev
Session Name: ICR_cmyc_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1422 		1563782400 1422
Screenshot not available
Click Here to view
 Description:
Author: sajjeev
Session Name: 07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1342 		1563782400 1342
Description:
Author: mauriege
Session Name: Fall21 Yeast test (GEM)
Genome Assembly: sacCer3
Creation Date: 2021-09-04
Views: 797 		1630742400 797
Description:
Author: celiagonzalez98
Session Name: Class 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1277 		1581321600 1277
Description:
Author: batra.anjali
Session Name: Spring19 Yeast test AB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1479 		1547193600 1479
Description:
Author: ruhollah
Session Name: hg19_1025_chr5_nmtf14
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1374 		1554105600 1374
Description:
Author: ruhollah
Session Name: hg19_830_chr6_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1396 		1554105600 1396
Description:
Author: ruhollah
Session Name: hg19_750_chr19_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1383 		1554105600 1383
Description:
Author: ruhollah
Session Name: hg19_199_chr8_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1395 		1554105600 1395
Description:
Author: ruhollah
Session Name: hg19_1405_chr16_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1680 		1554105600 1680
Description:
Author: ruhollah
Session Name: hg19_212_chr17_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1489 		1554105600 1489
Description:
Author: ruhollah
Session Name: hg19_131_chr2_nmtf17
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1411 		1554105600 1411
Description:
Author: ruhollah
Session Name: hg19_1163_chr1_nmtf18
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1455 		1554105600 1455
Description:
Author: ruhollah
Session Name: hg19_414_Chr8_nmtf19
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1443 		1554105600 1443
Description:
Author: ruhollah
Session Name: hg19_1617_chr1_nmtf20
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1440 		1554105600 1440
Description:
Author: ruhollah
Session Name: hg19_795_chr19_nmtf23
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1424 		1554105600 1424
Description: Tandemly repeated DNA sequences are widespread throughout the human genome and show sufficient variability among individuals in a population that they have become important in several fields including genetic mapping, linkage analysis, and human identity testing. These tandemly repeated regions of DNA are typically classified into several groups depending on the size of the repeat region. Minisatellites (variable number of tandem repeats, VNTRs) have core repeats with 9-80 bp, while microsatellites (short tandem repeats, STRs) contain 2-5 bp repeats. The forensic DNA community has moved primarily towards tetranucleotide repeats, which may be amplified using the polymerase chain reaction (PCR) with greater fidelity than dinucleotide repeats. The variety of alleles present in a population is such that a high degree of discrimination among individuals in the population may be obtained when multiple STR loci are examined.
Author: Hiram
Session Name: hg38.codis
Genome Assembly: hg38
Creation Date: 2018-05-10
Views: 1637 		1525939200 1637
Description:
Author: Boody09
Session Name: Boudreau Lab_human cardiac Ago2 HITS-CLIP
Genome Assembly: hg19
Creation Date: 2018-05-08
Views: 1826 		1525766400 1826
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;HCT116_vs_DKO1
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1360 		1566460800 1360
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;Mouse_OE
Genome Assembly: mm9
Creation Date: 2019-08-22
Views: 1206 		1566460800 1206
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;SH-SY5Y
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1270 		1566460800 1270
Description:
Author: AlicePsyche
Session Name: zebrafish_enhancers
Genome Assembly: danRer7
Creation Date: 2018-04-04
Views: 1549 		1522828800 1549
Description:
Author: tschauer
Session Name: Harpprecht_NAR
Genome Assembly: dm6
Creation Date: 2019-03-27
Views: 1474 		1553673600 1474
Description:
Author: Boonede
Session Name: Spring19 Yeast Test DB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1535 		1547193600 1535
Description:
Author: frongemg
Session Name: Spring19 Yeast test MGF
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1463 		1547193600 1463
Description:
Author: ruhollah
Session Name: hg19_172Chr3_nmt8
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1618 		1547452800 1618
Description:
Author: ruckerhr
Session Name: Spring19 Yeast HR
Genome Assembly: sacCer3
Creation Date: 2019-01-09
Views: 1513 		1547020800 1513
Description:
Author: ruckerhr
Session Name: TAS2R8group4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1615 		1547452800 1615
Description:
Author: Artem Babaian
Session Name: LIONS_ENCODE_supplement
Genome Assembly: hg19
Creation Date: 2019-01-09
Views: 1551 		1547020800 1551
Description:
Author: gerbermm
Session Name: Spring19 Yeast test MG
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1581 		1546934400 1581
Description:
Author: descentj
Session Name: Spring19YeastTestTD
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1606 		1546934400 1606
Description:
Author: shashipujar
Session Name: Multiz_conservation_SP
Genome Assembly: hg38
Creation Date: 2018-06-18
Views: 1710 		1529308800 1710
Description:
Author: agacita
Session Name: DYB_Promoter
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1506 		1548144000 1506
Description:
Author: lbenner
Session Name: fs(1)K741
Genome Assembly: dm6
Creation Date: 2017-09-11
Views: 1717 		1505116800 1717
Description:
Author: mersedehr
Session Name: NSUN4_v1_rs72886903
Genome Assembly: hg19
Creation Date: 2018-06-14
Views: 1512 		1528963200 1512
Description:
Author: [email protected]
Session Name: DGRP2snp
Genome Assembly: dm3
Creation Date: 2018-06-14
Views: 1486 		1528963200 1486
Description:
Author: Annaneed
Session Name: Anna_GEL
Genome Assembly: mm9
Creation Date: 2018-06-08
Views: 1231 		1528444800 1231
Screenshot not available
Click Here to view
 Description:
Author: view
Session Name: 11
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1551 		1545379200 1551
Description:
Author: GDJ_Duke
Session Name: Layden_liver_ATACseq
Genome Assembly: mm10
Creation Date: 2018-12-16
Views: 1469 		1544947200 1469
Description:
Author: nedbrewer66
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-12-18
Views: 1672 		1545120000 1672
Description:
Author: mfarkas03
Session Name: 1299To p53 mutants
Genome Assembly: hg19
Creation Date: 2018-06-07
Views: 1146 		1528358400 1146
Description:
Author: arem
Session Name: hg19-cc
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 1827 		1549612800 1827
Description:
Author: arem
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 1930 		1549612800 1930
Description:
Author: Mikhailova_li
Session Name: KB-1471A8.1
Genome Assembly: hg19
Creation Date: 2018-06-04
Views: 1784 		1528099200 1784
Description:
Author: Mikhailova_li
Session Name: session 3
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1567 		1528012800 1567
Description:
Author: Mikhailova_li
Session Name: session 1
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1566 		1528012800 1566
Description:
Author: brianlee
Session Name: hg38_chrM
Genome Assembly: hg38
Creation Date: 2018-06-01
Views: 1630 		1527840000 1630
Description: Our LOVD Variants track has variants from many LSDBs; our OMIM Alleles, GWAS Catalog, ClinVar Variants and other tracks in the Phenotypes & Literature group may provide clues to when a SNP is Clinical (LSDB,OMIM,TPA,Diagnostic)" per the Flagged SNPs track based on whether dbSNP's true-or-false "clinically-assoc" flag is set from NCBI's documentation.
Author: brianlee
Session Name: hg19_variants
Genome Assembly: hg19
Creation Date: 2018-06-01
Views: 1762 		1527840000 1762
Description:
Author: nehoralevi
Session Name: CTCF- macs2 control2
Genome Assembly: mm10
Creation Date: 2019-06-10
Views: 1385 		1560153600 1385
Description: Epigenome map of human fetal and iPSC-derived retinal pigment epithelium (RPE)
Author: s041629
Session Name: iPSCORE_RPE_session_hg19
Genome Assembly: hg19
Creation Date: 2018-05-31
Views: 1995 		1527753600 1995
Description: This session highlights data from the Brain Epigenome Hub, created by Peter Hickey, Lindsay Rizzardi, and Kaspar Hansen and others at Johns Hopkins University. The hub shows methylation, ATAC-seq, and RNAseq across different brain regions.
Author: chmalee
Session Name: hg19_brainEpigenome
Genome Assembly: hg19
Creation Date: 2018-05-30
Views: 2733 		1527667200 2733
Description:
Author: rezo
Session Name: ReCappable-seq
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 7077 		1565510400 7077
Description: 6 CLEAR-CLIP tracks from mouse keratinocytes in total. 3 showing CLEAR-CLIP reads from all miRNAs and 3 showing only miR-200 family specific reads. For each set of three there are Controls, miR-200 DKO and miR-200 inducible libraries.
Author: Bjerkega
Session Name: Bjerkega CLEAR-CLIP
Genome Assembly: mm10
Creation Date: 2019-10-04
Views: 1527 		1570176000 1527
Description:
Author: ltoker
Session Name: Marzi
Genome Assembly: hg19
Creation Date: 2021-01-05
Views: 1260 		1609833600 1260
Description:
Author: carlchancc
Session Name: 20191017_MC_Forelimb_Hindlimb_hg19
Genome Assembly: hg19
Creation Date: 2019-10-17
Views: 1493 		1571299200 1493
Description:
Author: hkao
Session Name: RHOA 2-2
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1341 		1562659200 1341
Description:
Author: hkao
Session Name: NEFM 1-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1378 		1562659200 1378
Description:
Author: ejlopezsoto
Session Name: Cacna1b e35-e41
Genome Assembly: hg19
Creation Date: 2019-07-11
Views: 1541 		1562832000 1541
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Tracks provided for age, sex and sample month.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele components
Genome Assembly: wuhCor1
Creation Date: 2020-04-29
Views: 1453 		1588147200 1453
Description:
Author: eldadshulman
Session Name: Homer_newaproch
Genome Assembly: mm10
Creation Date: 2019-06-30
Views: 1337 		1561881600 1337
Description:
Author: ruhollah
Session Name: hg19_162Chr19_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1445 		1547452800 1445
Description:
Author: 704855238
Session Name: chip-seq_LiuZX_seh1
Genome Assembly: rn6
Creation Date: 2018-05-24
Views: 1650 		1527148800 1650
Description:
Author: zhangr100
Session Name: AHBEC_VitD
Genome Assembly: hg19
Creation Date: 2019-04-04
Views: 1468 		1554364800 1468
Description:
Author: liqing9102
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-05-16
Views: 1638 		1526457600 1638
Description:
Author: avlasova
Session Name: tADseq.short-library.all_frames
Genome Assembly: hub_271523_TFbb_list180_linear
Creation Date: 2018-05-14
Views: 1725 		1526284800 1725
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome 2
Genome Assembly: hg19
Creation Date: 2020-02-27
Views: 1229 		1582790400 1229
Description:
Author: Vaa2001
Session Name: hg19_ASXL1Gen
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1302 		1571904000 1302
Description: one fly one genome: H3 hybrid fly, hybrid genome sequencing and assembly
Author: msadams
Session Name: H3-2_dm6
Genome Assembly: dm6
Creation Date: 2019-10-24
Views: 450 		1571904000 450
Screenshot not available
Click Here to view
 Description:
Author: eldadshulman
Session Name: endVsStart_chr1_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1366 		1525334400 1366
Screenshot not available
Click Here to view
 Description:
Author: eldadshulman
Session Name: apa_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1287 		1525334400 1287
Description:
Author: ruhollah
Session Name: hg19_148Chr2_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1385 		1547452800 1385
Description:
Author: che7oz
Session Name: hg19-IRF8-DCCC
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1605 		1538553600 1605
Description:
Author: estercastillo
Session Name: Reprogenetics_PGD
Genome Assembly: hg19
Creation Date: 2018-04-27
Views: 1566 		1524816000 1566
Description:
Author: lob5149
Session Name: TSC2
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1805 		1524729600 1805
Description:
Author: lob5149
Session Name: AKT1
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1594 		1524729600 1594
Description:
Author: lob5149
Session Name: MTOR
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1544 		1524729600 1544
Description:
Author: estercastillo
Session Name: JuanMartinez_LifeSeq_AS
Genome Assembly: hg19
Creation Date: 2018-04-22
Views: 1754 		1524384000 1754
Description:
Author: prutten
Session Name: rs6702619_3C-Seq_2replicates
Genome Assembly: hg19
Creation Date: 2015-03-17
Views: 1641 		1426579200 1641
Description:
Author: estercastillo
Session Name: Lara_AS_LaPaz
Genome Assembly: hg19
Creation Date: 2018-04-19
Views: 1689 		1524124800 1689
Description:
Author: roseaux12
Session Name: jinliying_nk
Genome Assembly: hg19
Creation Date: 2018-08-22
Views: 1617 		1534924800 1617
Description:
Author: celiagonzalez98
Session Name: class 3 part 1
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1224 		1581494400 1224
Description:
Author: arthurcheng
Session Name: hg38 ATAC-seq
Genome Assembly: hg38
Creation Date: 2019-01-23
Views: 861 		1548230400 861
Description:
Author: riguang zhao
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2019-03-12
Views: 1431 		1552377600 1431
Description:
Author: Xavier Rambout
Session Name: mm9 2019-03-11
Genome Assembly: mm9
Creation Date: 2019-03-11
Views: 1253 		1552291200 1253
Description:
Author: ruhollah
Session Name: hg19_128Chr19+167Chr19_nmt11+11
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1448 		1547452800 1448
Description:
Author: Camila
Session Name: Enhancers-BreastCancersCells
Genome Assembly: hg19
Creation Date: 2018-04-21
Views: 1536 		1524297600 1536
Description:
Author: micca
Session Name: mm9_Buecker2014
Genome Assembly: mm9
Creation Date: 2018-04-03
Views: 1555 		1522742400 1555
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. Only the "UCSC Genes" track is enabled, showing two of the gene's potential isoforms. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 551 		1658390400 551
Description:
Author: Jcotney
Session Name: Mouse_chromhmm_15_18_state
Genome Assembly: mm10
Creation Date: 2018-10-20
Views: 639 		1540022400 639
Description:
Author: arem
Session Name: colon meth
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1348 		1551859200 1348
Description:
Author: jtm
Session Name: shiny_app_hg38_v0
Genome Assembly: hg38
Creation Date: 2018-03-28
Views: 4105 		1522224000 4105
Description:
Author: Hanson258
Session Name: DNA Damage ChIP-seq
Genome Assembly: hg38
Creation Date: 2018-07-17
Views: 2207 		1531814400 2207
Description:
Author: ldistefano
Session Name: dm6_DiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1327 		1552377600 1327
Screenshot not available
Click Here to view
 Description:
Author: jtm
Session Name: shiny_app_mm10_v0
Genome Assembly: mm10
Creation Date: 2018-04-04
Views: 2078 		1522828800 2078
Description:
Author: cocopow
Session Name: hg38_nucs
Genome Assembly: hg38
Creation Date: 2019-04-23
Views: 1355 		1556006400 1355
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: videoDemo1
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 1638 		1520928000 1638
Description:
Author: nehoralevi
Session Name: mm10-CTCF
Genome Assembly: mm10
Creation Date: 2019-06-03
Views: 2061 		1559548800 2061
Description: The GeneHancer database links human regulatory elements (enhancers and promoters) as arcs to their inferred target genes. Over 1 million regulatory elements obtained from seven genome-wide databases by GeneHancer are visualizable on the human hg19 and hg38 assemblies as color-coded curves ending on their respective targets. Read more about GeneHancer data on the track description page and this article <a href="https://www.ncbi.nlm.nih.gov/pubmed/28605766">GeneHancer: genome-wide integration of enhancers and target genes in GeneCards.</a>
Author: PublicSessions
Session Name: GeneHancer
Genome Assembly: hg38
Creation Date: 2019-05-31
Views: 1684 		1559289600 1684
Description:
Author: [email protected]
Session Name: extended BACs and FOSMIDs
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1613 		1553673600 1613
Description:
Author: AnaïsTest
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 1779 		1559808000 1779
Description:
Author: brianlee
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 1625 		1559808000 1625
Description:
Author: emmawentworth
Session Name: hg19-PWS
Genome Assembly: hg19
Creation Date: 2019-06-05
Views: 1732 		1559721600 1732
Description:
Author: cocopow
Session Name: mm10_altStrains
Genome Assembly: mm10
Creation Date: 2019-06-05
Views: 1379 		1559721600 1379
Description:
Author: evan_pepper
Session Name: extra_tRNAs_Analysis
Genome Assembly: hg19
Creation Date: 2018-03-08
Views: 1672 		1520496000 1672
Description:
Author: hchen17
Session Name: 20180307_1300_RESULTS_6pelvicFinStickleOut
Genome Assembly: hub_207981_oryLat03
Creation Date: 2018-03-07
Views: 1514 		1520409600 1514
Description:
Author: lboteva
Session Name: mm10_rif1_HP_
Genome Assembly: mm10
Creation Date: 2019-05-30
Views: 1592 		1559203200 1592
Description:
Author: lbennett
Session Name: impdh1retina
Genome Assembly: hg19
Creation Date: 2018-03-06
Views: 1618 		1520323200 1618
Description:
Author: ruhollah
Session Name: 12_ruh
Genome Assembly: hg38
Creation Date: 2018-11-13
Views: 1442 		1542096000 1442
Description:
Author: ruhollah
Session Name: hg19_2_chr8
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1471 		1543219200 1471
Description:
Author: yezheng
Session Name: HiC_ChIP-seq_short
Genome Assembly: hg19
Creation Date: 2018-03-04
Views: 1667 		1520150400 1667
Description:
Author: holdenl
Session Name: danRer11 zebrafish CNV across strains
Genome Assembly: danRer11
Creation Date: 2018-03-03
Views: 2098 		1520064000 2098
Description:
Author: estercastillo
Session Name: MartaRodriguez_Reus
Genome Assembly: hg19
Creation Date: 2018-02-28
Views: 1771 		1519804800 1771
Description:
Author: BenjaminMartin02
Session Name: Stefanska_data
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 1975 		1518595200 1975
Description:
Author: labrozam
Session Name: CGEMS Yeast AL
Genome Assembly: sacCer3
Creation Date: 2016-11-05
Views: 1875 		1478332800 1875
Description:
Author: labrozam
Session Name: CGEMS Worm AL test
Genome Assembly: ce11
Creation Date: 2016-11-20
Views: 1744 		1479628800 1744
Description:
Author: labrozam
Session Name: CGEMS Mouse AL test
Genome Assembly: mm9
Creation Date: 2016-11-29
Views: 2418 		1480406400 2418
Description:
Author: labrozam
Session Name: CGEMS Human AL test
Genome Assembly: hg38
Creation Date: 2016-11-21
Views: 1731 		1479715200 1731
Description:
Author: labrozam
Session Name: Anna-rs72802342
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 1996 		1509436800 1996
Description:
Author: jwjiao
Session Name: H2ZKO_E16_WT_E16
Genome Assembly: hg38
Creation Date: 2018-02-26
Views: 1632 		1519632000 1632
Description:
Author: [email protected]
Session Name: MMR_branchpoints-230218
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1576 		1519286400 1576
Description:
Author: yierjin_2008
Session Name: KMS12BM
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1696 		1519286400 1696
Description: This session is an example of using the Short Match track to search a sequence in the current view with the IUPAC codes. The input of WACMKGTW catches two matches. The session also using a feature of the Base Position track. You can highlight specific nucleotides with that track and AAC are selected to be highlighted (note, there is also a step taken to check the box to show reverse complements of motifs). This region you will see AACATGTT and another reverse strand AACCTGTA, which appears to work with the IUPAC codes: http://genome.ucsc.edu/goldenPath/help/iupac.html The Base Track and the Short Match track allow you to investigate the sequence in the current view when zoomed in with these highlight and search features.
Author: brianlee
Session Name: hg38.WACMKGTW
Genome Assembly: hg38
Creation Date: 2018-02-21
Views: 837 		1519200000 837
Description:
Author: simonwang612
Session Name: worm-chip-L4
Genome Assembly: ce10
Creation Date: 2018-02-20
Views: 1594 		1519113600 1594
Description:
Author: simonwang612
Session Name: worm-chip
Genome Assembly: ce10
Creation Date: 2018-02-19
Views: 1750 		1519027200 1750
Description:
Author: estercastillo
Session Name: JudithArmstrong_predisposicio
Genome Assembly: hg19
Creation Date: 2018-02-18
Views: 1576 		1518940800 1576
Description:
Author: Mannu Walia
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1602 		1544688000 1602
Description:
Author: AnUnroyalKing
Session Name: Gene_File_King
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 1544 		1518681600 1544
Description:
Author: cmhct7
Session Name: Mouse Quad Data
Genome Assembly: mm10
Creation Date: 2016-09-12
Views: 1812 		1473667200 1812
Description:
Author: clauhag
Session Name: ContactSites_mixedpopulations
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 1975 		1482048000 1975
Description:
Author: clauhag
Session Name: ContactSites_clones
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 1897 		1482048000 1897
Description:
Author: ascendgene
Session Name: 60genes panel chr11
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1721 		1532505600 1721
Description:
Author: zunpengliu66
Session Name: WT and DGCR8_dex2 H3K9me3 ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-04-11
Views: 1519 		1523433600 1519
Description:
Author: samross
Session Name: danRer7_48hpf_6dpfbrain_RRBS
Genome Assembly: danRer7
Creation Date: 2018-02-14
Views: 1554 		1518595200 1554
Description:
Author: Lorena8a
Session Name: trabajo genomics HSC
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 1679 		1518595200 1679
Description:
Author: oac7
Session Name: oac7_hg19_all_snvs
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1715 		1518508800 1715
Description:
Author: AnUnroyalKing
Session Name: Ian_King_Settings
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1762 		1518508800 1762
Description:
Author: marzoldr
Session Name: hg38 MAPT density graphs and such
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1589 		1518508800 1589
Description:
Author: marzoldr
Session Name: hg38 MAPT alleles
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1582 		1518508800 1582
Description:
Author: marzoldr
Session Name: hg19 RHO custom 1
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1574 		1518508800 1574
Description: This assembly hub for the CG2 clonal zebrafish is part of a much larger collection of assembly hubs. The hub details can be found on the gateway page for this hub <a href="http://genome.ucsc.edu/cgi-bin/hgGateway?hubUrl=http://genome-test.cse.ucsc.edu/gbdb/hubs/genbank/vertebrate_other/hub.ncbi.txt&genome=GCA_001483285.1_CG2v1.0&position=lastDbPos" >found here.</a> The hub is Biosample: SAMN03964926 and has Assembly accession ID: GCA_001483285.1. <br> <br> The hub is is part of this much larger assembly hub collection, with a launching page <a href="http://genome-test.cse.ucsc.edu/~hiram/hubs/genbank/vertebrate_mammalian/vertebrate_mammalian.ncbi.html" >found here</a> (note these will launch on our test development site as this hub is considered a prototype and hasn't passed quality control). Once connected to the above hub you have access to all of these hubs, the launching page only makes it more easy to directly link to the Track Browsing page. When connected one can also go to the Gateway page (earlier link) and see a <b>Download files for this assembly hub:</b> section with a <code>wget</code> command to access all the files for these assembly hubs.
Author: brianlee
Session Name: CG2zebrafish
Genome Assembly: hub_89563_GCA_001483285.1_CG2v1.0
Creation Date: 2018-07-06
Views: 1590 		1530864000 1590
Description:
Author: AnUnroyalKing
Session Name: King_setting
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 1824 		1518681600 1824
Description:
Author: estercastillo
Session Name: pseudogens
Genome Assembly: hg19
Creation Date: 2018-01-31
Views: 2358 		1517385600 2358
Description:
Author: marylaws
Session Name: foxm1 chip comparison
Genome Assembly: hg19
Creation Date: 2018-02-07
Views: 1558 		1517990400 1558
Description:
Author: marylaws
Session Name: FOXM 231 and mcf7
Genome Assembly: hg18
Creation Date: 2018-02-07
Views: 1893 		1517990400 1893
Description: This session illustrates the meaning of columns in the axt file definition here, http://genome.ucsc.edu/goldenPath/help/axt.html You can see that indeed if you subtract to find the differences in the primary organism coordinates (panTro4: 78679-77637 = 1,042) it will be different than the values in the aligning organism coordinates (hg19: 88869-87772 = 1,097), but in the primary assembly sequence line you can see where there isn't a match in more than one place (most notable gct---------------------------------------------------ctt) as seen in this alignment of hg19 to panTro4. See the mailing list question here: <a href="https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/-ohoSCyPIT0/c5nP7NzOBQAJ">link</a>.
Author: brianlee
Session Name: hg19.panTro4
Genome Assembly: hg19
Creation Date: 2018-02-02
Views: 1531 		1517558400 1531
Description:
Author: marzoldr
Session Name: TAS2R38 (T1)
Genome Assembly: hg19
Creation Date: 2018-01-23
Views: 1847 		1516694400 1847
Description:
Author: yezheng
Session Name: ATAC-seq_ALA_mm9
Genome Assembly: mm9
Creation Date: 2018-01-25
Views: 1679 		1516867200 1679
Description:
Author: Colin Logie
Session Name: forsubmission2bioRxiv_new
Genome Assembly: hg19
Creation Date: 2018-01-22
Views: 1682 		1516608000 1682
Description:
Author: ascendgene
Session Name: hg19_chr16:21960001-22400001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 1642 		1516521600 1642
Description:
Author: chouhj
Session Name: noCHX_2017
Genome Assembly: sacCer3
Creation Date: 2017-08-14
Views: 1662 		1502697600 1662
Description:
Author: chouhj
Session Name: 46Del_2016batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 1689 		1483603200 1689
Description:
Author: chouhj
Session Name: 11Del_2015batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 1884 		1483603200 1884
Description:
Author: chmalee
Session Name: hg38notableChrYFeatures
Genome Assembly: hg38
Creation Date: 2017-03-06
Views: 1857 		1488787200 1857
Description:
Author: ascendgene
Session Name: hg19_chr15:32,020,001-32,420,001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 2171 		1516521600 2171
Description:
Author: FrankaRang
Session Name: FR180123_mm10_groupmeeting
Genome Assembly: mm10
Creation Date: 2018-01-23
Views: 1903 		1516694400 1903
Description:
Author: zheyangshan
Session Name: EGFR BOTH
Genome Assembly: hg19
Creation Date: 2018-12-14
Views: 1357 		1544774400 1357
Description:
Author: rnaguru
Session Name: mm9-pY-MEME
Genome Assembly: mm9
Creation Date: 2018-01-18
Views: 1790 		1516262400 1790
Description: This assembly hub has a sequence that translates into a fun message when looking at codon translations.
Author: brianlee
Session Name: PAG_FUN
Genome Assembly: hub_211929_yourGenome
Creation Date: 2018-01-16
Views: 1758 		1516089600 1758
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage10.WT.Clone5.DKO.clone7
Genome Assembly: mm10
Creation Date: 2018-01-12
Views: 1566 		1515744000 1566
Description:
Author: marzoldr
Session Name: Spring18 Yeast Test DMLJ
Genome Assembly: sacCer3
Creation Date: 2018-01-09
Views: 1570 		1515484800 1570
Description: This session shows TRPV3 which researchers believe is involved in our ability to sense and detect warm temperature. Scripps Research Institute scientists have demonstrated that mice lacking the TRPV3 protein have specific deficiencies in their ability to detect temperatures.
Author: brianlee
Session Name: skin_heat_sense
Genome Assembly: hg19
Creation Date: 2022-01-03
Views: 503 		1641196800 503
Description:
Author: megas
Session Name: hg19 Chip-Seq Encode vs mm10
Genome Assembly: hg19
Creation Date: 2018-01-02
Views: 1753 		1514880000 1753
Description: test the details .
Author: greece2019
Session Name: hg19_b0b1
Genome Assembly: hg19
Creation Date: 2019-03-03
Views: 1595 		1551600000 1595
Description:
Author: jkrakowiak
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-12-18
Views: 2047 		1513584000 2047
Description:
Author: jwjiao
Session Name: rbm3
Genome Assembly: mm10
Creation Date: 2017-12-17
Views: 1592 		1513497600 1592
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rheMac2 circRNA annotation
Genome Assembly: rheMac2
Creation Date: 2016-09-25
Views: 1152 		1474790400 1152
Description:
Author: mazawm
Session Name: hg#19RHO
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1372 		1542096000 1372
Description:
Author: Heywhoyou22
Session Name: Nrl and wt Cbr sites
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1427 		1542096000 1427
Description:
Author: nedbrewer66
Session Name: NAT7
Genome Assembly: hg38
Creation Date: 2018-12-28
Views: 1423 		1545984000 1423
Description:
Author: caojun
Session Name: Amr-20161031
Genome Assembly: mm9
Creation Date: 2016-10-31
Views: 1787 		1477900800 1787
Description:
Author: butlertj3
Session Name: nuc_g4
Genome Assembly: hg38
Creation Date: 2018-06-05
Views: 1806 		1528185600 1806
Description:
Author: butlertj3
Session Name: mtDNA_G4_homo_hetero
Genome Assembly: hg38
Creation Date: 2018-04-10
Views: 1687 		1523347200 1687
Description:
Author: brianlee
Session Name: sacCer3_spots
Genome Assembly: sacCer3
Creation Date: 2017-10-31
Views: 1768 		1509436800 1768
Description:
Author: brianlee
Session Name: hg38_interact_example
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 1459 		1541404800 1459
Description:
Author: brianlee
Session Name: hg38_GTEX_SUN
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 1645 		1523606400 1645
Description:
Author: brianlee
Session Name: hg38.exampleTracks
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 1593 		1497945600 1593
Description:
Author: brianlee
Session Name: hg38.SIRT1.relatedExpression
Genome Assembly: hg38
Creation Date: 2017-05-23
Views: 2057 		1495526400 2057
Description:
Author: brianlee
Session Name: hg19.pgSnpExample
Genome Assembly: hg19
Creation Date: 2017-07-19
Views: 1584 		1500451200 1584
Description:
Author: brianlee
Session Name: hg19.longTabix
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 1677 		1495612800 1677
Description: This session shows a search of primers. A researcher had an issue building PCR primers and Browser staff discovered that a desired reverse primer falls into an area of repeats.  The original primer at 20 bases was near the limit of BLAT's sensitivity. With such short sequences, if BLAT has an over-used tile, a section of the query used to match and trigger an alignment, the algorithm will not be able to seed and extend an original BLAT hit in an area of repeats, which was what was likely happening to the reverse primer sequence in this session. In the session a larger BLAT query will result in a hit. Since primers are typically chosen from unique locations, Browser staff suggested it might be best to avoid a repeat-region, and noted that the nearby chr13:50,593,214-50,593,267 section appears to not have any repeats.
Author: brianlee
Session Name: Primers Blat Search
Genome Assembly: hg19
Creation Date: 2013-07-23
Views: 419 		1374566400 419
Description: This FORWARD strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds FORWARD
Genome Assembly: hg19
Creation Date: 2013-08-01
Views: 294 		1375344000 294
Description: This REVERSE strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds
Genome Assembly: hg19
Creation Date: 2013-07-31
Views: 266 		1375257600 266
Description:
Author: bisrat
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2017-12-14
Views: 1618 		1513238400 1618
Description:
Author: bisrat
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-18
Views: 1848 		1537257600 1848
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1516 		1536048000 1516
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1461 		1542096000 1461
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1485 		1542096000 1485
Description:
Author: benbeijs
Session Name: ENCODE Exercise
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1448 		1542096000 1448
Description:
Author: benbeijs
Session Name: DSP (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 1530 		1536134400 1530
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), Exercise 3
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1453 		1538467200 1453
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage.Higher.10
Genome Assembly: mm10
Creation Date: 2017-12-12
Views: 1618 		1513065600 1618
Description:
Author: nicklewis
Session Name: AMD SNP Second Try
Genome Assembly: hg19
Creation Date: 2017-11-02
Views: 1551 		1509609600 1551
Description:
Author: nicklewis
Session Name: AMD SNP Custom Tracks
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1571 		1509436800 1571
Description:
Author: cocapo
Session Name: hg38_multiWig_noOverlay
Genome Assembly: hg38
Creation Date: 2018-12-13
Views: 1427 		1544688000 1427
Description:
Author: roseaux12
Session Name: 3_subset_nk
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1433 		1544688000 1433
Description:
Author: abner_lim
Session Name: OVcar
Genome Assembly: hg19
Creation Date: 2018-12-09
Views: 1464 		1544342400 1464
Description:
Author: GenePeeks
Session Name: .2017.12 60bp Multi-Seq-Alg
Genome Assembly: hg19
Creation Date: 2017-12-10
Views: 1482 		1512892800 1482
Description:
Author: rnkeith
Session Name: dm6_first_ribo-seq
Genome Assembly: dm6
Creation Date: 2019-05-02
Views: 1290 		1556784000 1290
Description:
Author: cath
Session Name: v440hgw0Test
Genome Assembly: hg38
Creation Date: 2016-10-25
Views: 1651 		1477382400 1651
Description:
Author: cath
Session Name: MLQ19469
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 1993 		1495612800 1993
Description: These are the 12 UCSC Browser tracks for the RNA-seq experiment in which humanized and WT yeast were subjected to 1 hour of splicing inhibitors. There are six libraries in duplicate. humanized hsh155 with DMSO carrier humanized hsh155 with 5 uM pladienolide-b humanized hsh155 with 0.5 uM pladienolide-b humanized hsh155 with 5 uM thailanstatin-a WT Hsh155 with DMSO carrier WT Hsh155 with 5 uM pladienolide-b
Author: ohunter
Session Name: Hunter_et_al_sacCer3_Yeast_Splicing_Inhibition
Genome Assembly: sacCer3
Creation Date: 2023-07-25
Views: 377 		1690272000 377
Description:
Author: cocopow
Session Name: hg18_44way
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1434 		1563955200 1434
Description:
Author: kinerettaler
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2018-12-30
Views: 1436 		1546156800 1436
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. The interactions track in the pack setting allows for a pack view of the data with the direction and name of individual endpoints clearly displayed. A highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancerPack
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1296 		1553846400 1296
Description: The JASPAR 2018 TFB Public Hub represents genome-wide predicted binding sites for TF (transcription factor) binding profiles in the JASPAR CORE vertebrates collection. Please click into the Track Description pages to see more details and credits and contacts for the hub's data.
Author: brianlee
Session Name: hg38.JASPARhub
Genome Assembly: hg38
Creation Date: 2017-09-29
Views: 2283 		1506672000 2283
Description: With this session loaded navigate to the Variant Annotation Integrator (VAI) tool (under the top blue bar Tools menu). Then scroll down and click the "Get results" button to experience how the VAI tool can now output HGVS terms. This session is loaded with an artificial input of variants on the human hg38 assembly with NCBI RefSeq Genes track (curated NM_*, NR_*, and YP_* subset) filtered for coding exons and splice site roles and on DNase regulatory elements with output in HTML Variant Effect Predictor format where the "Extra" column will include HGVS notation. Please note that a semi-colon ";" will separate results in that field (HGVSG=NC_000010.11:g.27005592_27005594delAGA; HGVSCN=NM_014915.2:c.5129_5131delTCT; EXON=34/34).
Author: brianlee
Session Name: hg38.exampleVAI
Genome Assembly: hg38
Creation Date: 2017-09-25
Views: 4244 		1506326400 4244
Description:
Author: rasou2ba
Session Name: Bio 630 CRX variants Rasoul
Genome Assembly: hg38
Creation Date: 2017-09-27
Views: 1516 		1506499200 1516
Description:
Author: lianeslaughter
Session Name: mm9-Locus3_primerDesign
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 1600 		1506412800 1600
Description:
Author: Cong Guo
Session Name: IDEAS Blank
Genome Assembly: hg19
Creation Date: 2017-09-26
Views: 1499 		1506412800 1499
Description:
Author: Lou
Session Name: pisOchAsseblyHub
Genome Assembly: hub_1100339_12Jun2017_28pcJ
Creation Date: 2019-04-22
Views: 1608 		1555920000 1608
Description:
Author: peytonse
Session Name: Bio 630 CRX variants Peyton
Genome Assembly: hg38
Creation Date: 2017-09-20
Views: 1589 		1505894400 1589
Description:
Author: nickcochran
Session Name: BE2C_MAPT_9-18-17
Genome Assembly: hg19
Creation Date: 2017-09-18
Views: 1854 		1505721600 1854
Description:
Author: morotz
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-09-14
Views: 1671 		1505376000 1671
Description:
Author: EvansLab
Session Name: EY_ATAC_Ileum
Genome Assembly: mm9
Creation Date: 2017-09-12
Views: 1572 		1505203200 1572
Description:
Author: mcgaughey
Session Name: mm10_retina_epigenetics
Genome Assembly: mm10
Creation Date: 2017-08-11
Views: 1815 		1502438400 1815
Description:
Author: yezheng
Session Name: HiC_ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-03-02
Views: 1558 		1519977600 1558
Description:
Author: leggeteg
Session Name: Leggett, BIO480Uba1 example
Genome Assembly: hg19
Creation Date: 2017-09-06
Views: 1585 		1504684800 1585
Description:
Author: ofery1984
Session Name: FINAL Meth + RNA
Genome Assembly: mm10
Creation Date: 2017-09-06
Views: 984 		1504684800 984
Description:
Author: mccarthyti
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-08-30
Views: 1632 		1504080000 1632
Description:
Author: jcarlevaro
Session Name: TE_paper_hg38
Genome Assembly: hg38
Creation Date: 2017-08-28
Views: 1545 		1503907200 1545
Description: We are pleased to add the UniBind Hub to our list of publicly available track hubs. UniBind is a comprehensive map of direct transcription factor - DNA interactions in the human genome. UniBind expands on the previous data and is now available on GRCh38/hg38. Below is a session highlighting UniBind transcription factor-DNA binding interactions in the SPR gene. http://genome.ucsc.edu/s/dschmelt/UniBindSRF More info on UniBind: https://unibind.uio.no We would like to thank the Mathelier Lab at the University of Oslo for creating this hub!
Author: dschmelt
Session Name: UniBindSRF
Genome Assembly: hg38
Creation Date: 2019-04-17
Views: 2247 		1555488000 2247
Description:
Author: oac7
Session Name: oac7_Problem_Set_2
Genome Assembly: hg19
Creation Date: 2018-03-01
Views: 1548 		1519891200 1548
Description: This data includes Bcl11b ChIP-seq result.
Author: liuxiaoqin
Session Name: bcl11b-liuxiaoqin
Genome Assembly: mm10
Creation Date: 2022-08-17
Views: 431 		1660723200 431
Description:
Author: aniclem
Session Name: Clem, BIO480 Uba 1 example
Genome Assembly: hg19
Creation Date: 2017-09-03
Views: 1588 		1504425600 1588
Description:
Author: EvansLab
Session Name: Eiji-ATACseq2
Genome Assembly: hg19
Creation Date: 2017-07-10
Views: 1762 		1499673600 1762
Description:
Author: EvansLab
Session Name: EY_ATAC_Intes_Organoids
Genome Assembly: mm9
Creation Date: 2017-07-26
Views: 1902 		1501056000 1902
Description: Visualization in UCSC Genome Browser of genome coverages of all generated next-generation sequencing data included in the manuscript ('A novel approach for DNA footprinting using short double-stranded cell-free DNA from plasma').
Author: jnmllr
Session Name: Short_cfDNA_seq_manuscript
Genome Assembly: hg19
Creation Date: 2024-02-13
Views: 120 		1707811200 120
Description:
Author: svadlamudi
Session Name: KSR2_7-24-17
Genome Assembly: hg19
Creation Date: 2017-07-24
Views: 1728 		1500883200 1728
Description:
Author: jwjiao
Session Name: H2AZ-ChIP-E13-Cortex
Genome Assembly: mm10
Creation Date: 2017-07-13
Views: 1738 		1499932800 1738
Description: This session is a response to question for research on Myc binding sites on the IDH1 gene promoter, with a desire to analyze the conservation of Myc binding sites between human and mouse. In the session Transcription Factor ChIP-seq (161 factors) from ENCODE track is displayed and three MYC binding spots represented. This clustered transcription factor binding track can be sorted to display only certain factors like MYC. Below the MYC binding spots (wgEncodeRegTfbsClusteredV3 track) the conservation data from 100 assembly alignments are displayed (cons100way track), with the specific data from mouse selected. Further below that the Chain/Net data (placentalChainNet track) specific for mouse are also displayed. To see this question on our Mailing List click this link: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/94u1jx2bk6c/py3OD90WAQAJ
Author: brianlee
Session Name: hg19.mycBinding2
Genome Assembly: hg19
Creation Date: 2017-07-13
Views: 1653 		1499932800 1653
Description:
Author: cocopow
Session Name: rn6_23676
Genome Assembly: rn6
Creation Date: 2019-06-20
Views: 1520 		1561017600 1520
Description:
Author: cocopow
Session Name: hg19_hubs
Genome Assembly: hg19
Creation Date: 2019-06-18
Views: 1312 		1560844800 1312
Description:
Author: Adhil
Session Name: sacCer3_supercoiling
Genome Assembly: sacCer3
Creation Date: 2019-06-17
Views: 1375 		1560758400 1375
Description:
Author: Joey Riepsaame
Session Name: mm9 DNAseI digital Me1 Me3 Ac27 Pol2
Genome Assembly: mm9
Creation Date: 2015-07-14
Views: 1040 		1436860800 1040
Description:
Author: janzop
Session Name: hsa_all_cccDNA_HBx_mRNA
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 2143 		1497945600 2143
Description:
Author: phageghost
Session Name: glasslab_microglia_hg38
Genome Assembly: hg38
Creation Date: 2017-06-19
Views: 1803 		1497859200 1803
Description:
Author: phageghost
Session Name: glasslab_microglia_mm10
Genome Assembly: mm10
Creation Date: 2017-06-19
Views: 1584 		1497859200 1584
Description: This sessionView is a collection of tracks centered around gene expression. The display is organized with gene annotations first, followed by mRNA and smRNA evidence. Following these data are <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx tracks</a> which display median gene expression and transcripts from 51 tissues and 2 cells lines. The final tracks in this collection provide additional expression support: TSS/Dnase/chromatin state. The region visualized is a ~10,200bp window covering two <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1891803/" target="_blank">HOX genes</a> which are regulators for embryonic development and continue to be expressed throughout postnatal life.
Author: view
Session Name: Expression
Genome Assembly: hg19
Creation Date: 2018-10-08
Views: 1545 		1538985600 1545
Description:
Author: nickcochran
Session Name: BE2C-Candidates-6-9-17
Genome Assembly: hg19
Creation Date: 2017-06-09
Views: 1654 		1496995200 1654
Description:
Author: ezra abramms
Session Name: nebulin bam site two
Genome Assembly: mm10
Creation Date: 2017-06-05
Views: 1813 		1496649600 1813
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp, Mouse, Chicken, Zebrafish
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1596 		1507622400 1596
Description:
Author: peijinlim
Session Name: mm9 Nrf2 ChIPseq Mrp2
Genome Assembly: mm9
Creation Date: 2017-06-01
Views: 1683 		1496304000 1683
Description:
Author: yang1221720
Session Name: KDM3A_splicing
Genome Assembly: hg38
Creation Date: 2018-11-22
Views: 1403 		1542873600 1403
Description:
Author: ifollon
Session Name: hg19_sangre2
Genome Assembly: hg19
Creation Date: 2017-05-30
Views: 1749 		1496131200 1749
Description:
Author: jwrows2014
Session Name: EPAS1 search 5272017
Genome Assembly: hg38
Creation Date: 2017-05-27
Views: 1604 		1495872000 1604
Description: This session uses a new format called type=longTabix, here is a mailing list describing this type: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ This new type uses a custom track that points to a .gz file, and where that is located there is also a .gz.tbi file that provides the index. The tab-separated .gz file has contents like the following: chr19 44116910 44119168 chr21:47876840-47878656,2 31515 . The .tbi file is built using the tabix software from: http://samtools.sourceforge.net/tabix.shtml
Author: brianlee
Session Name: hg19.other_regions
Genome Assembly: hg19
Creation Date: 2017-05-25
Views: 1701 		1495699200 1701
Description:
Author: Fadak Alali
Session Name: Fall19 Yeast test FA
Genome Assembly: sacCer3
Creation Date: 2019-08-31
Views: 1277 		1567238400 1277
Description:
Author: ephong0305
Session Name: GeM MOA HD GWAS.v9
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 1342 		1570176000 1342
Description:
Author: Bowen
Session Name: hg38_HBB_rs334
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1328 		1571904000 1328
Description:
Author: anneabraham1
Session Name: MAPT mutant alleles Anne Abraham
Genome Assembly: hg38
Creation Date: 2018-02-12
Views: 1570 		1518422400 1570
Description:
Author: XiangChen
Session Name: Bio481 Chen AMD SNPs rs67538026
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 2180 		1509436800 2180
Description:
Author: heathhm
Session Name: FALL19 Yeast test HMH
Genome Assembly: sacCer3
Creation Date: 2019-08-30
Views: 1418 		1567152000 1418
Description:
Author: farshad
Session Name: BRCA_hg19_H3K27Ac_related_profiles20170517
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 1849 		1495008000 1849
Description:
Author: ekrobins
Session Name: TSS_CAGE
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 2205 		1495008000 2205
Description:
Author: nbosch
Session Name: CRIM1
Genome Assembly: hg19
Creation Date: 2017-05-15
Views: 1668 		1494835200 1668
Description:
Author: brianlee
Session Name: hg38.refSeq.UCSC
Genome Assembly: hg38
Creation Date: 2017-05-12
Views: 1833 		1494576000 1833
Description:
Author: Francesco_Ferrari
Session Name: rs7599312_SNP
Genome Assembly: hg19
Creation Date: 2017-10-17
Views: 1548 		1508227200 1548
Description:
Author: sajjeev
Session Name: progeria_JB
Genome Assembly: mm10
Creation Date: 2019-05-23
Views: 1766 		1558598400 1766
Description:
Author: suestring
Session Name: example_DCdiffCA
Genome Assembly: hub_432097_DC
Creation Date: 2019-05-22
Views: 1430 		1558512000 1430
Description:
Author: suestring
Session Name: hub_432097_ZebraFish
Genome Assembly: hub_432097_ZebraFish
Creation Date: 2019-05-28
Views: 2179 		1559030400 2179
Description: Main overview of the ARID1a gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: arid1a_home
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 533 		1660896000 533
Description:
Author: cocopow
Session Name: hg38_primates
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1373 		1557388800 1373
Description:
Author: russiandash
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-05-13
Views: 3961 		1557734400 3961
Description:
Author: DearDanielxd
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-04-25
Views: 1694 		1493107200 1694
Description:
Author: yayinano
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-04-21
Views: 1913 		1492761600 1913
Description:
Author: linzho
Session Name: Zoltan_SA3_chip_data
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1338 		1557907200 1338
Description:
Author: swarnaseetha
Session Name: TET5hmcTriplicates
Genome Assembly: mm10
Creation Date: 2019-10-08
Views: 1335 		1570521600 1335
Description:
Author: [email protected]
Session Name: hg19_GJB2
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1363 		1557907200 1363
Description:
Author: [email protected]
Session Name: hg19_SLC26A4
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1334 		1557907200 1334
Description:
Author: sayloren
Session Name: hg19-chr12-probes
Genome Assembly: hg19
Creation Date: 2017-04-07
Views: 1800 		1491552000 1800
Description:
Author: GDJ_Duke
Session Name: SJC_BAC_Lib_GDJ_PER1_BAC
Genome Assembly: hg38
Creation Date: 2018-09-06
Views: 1553 		1536220800 1553
Description:
Author: liyq
Session Name: mm10_2016
Genome Assembly: mm10
Creation Date: 2017-03-18
Views: 1648 		1489824000 1648
Description:
Author: PublicSessions
Session Name: N-masked regions on the Y chromosome for hg38
Genome Assembly: hg38
Creation Date: 2017-03-14
Views: 1834 		1489478400 1834
Description:
Author: gartnerj928
Session Name: Devi_methyl_IP_tracks
Genome Assembly: mm10
Creation Date: 2017-03-13
Views: 2387 		1489392000 2387
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1739 		1489132800 1739
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2051 		1489132800 2051
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1667 		1489132800 1667
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1639 		1489132800 1639
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1680 		1489132800 1680
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1664 		1489132800 1664
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1726 		1489132800 1726
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1674 		1489132800 1674
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1854 		1489132800 1854
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1657 		1489132800 1657
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1662 		1489132800 1662
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1593 		1489132800 1593
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1638 		1489132800 1638
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1658 		1489132800 1658
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1695 		1489132800 1695
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1673 		1489132800 1673
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1616 		1489132800 1616
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1681 		1489132800 1681
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1616 		1489132800 1616
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1625 		1489132800 1625
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1775 		1489132800 1775
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1614 		1489132800 1614
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1657 		1489132800 1657
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1766 		1489132800 1766
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1625 		1489132800 1625
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1795 		1489132800 1795
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1679 		1489132800 1679
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1667 		1489132800 1667
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1593 		1489132800 1593
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1587 		1489132800 1587
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1646 		1489132800 1646
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1635 		1489132800 1635
Description:
Author: xulab
Session Name: tps_E14_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1676 		1489132800 1676
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1751 		1489132800 1751
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1597 		1489132800 1597
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1853 		1489132800 1853
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1777 		1489132800 1777
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1728 		1489132800 1728
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1575 		1489132800 1575
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2034 		1489132800 2034
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1729 		1489132800 1729
Description:
Author: xulab
Session Name: tps_ALL_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1843 		1489132800 1843
Description:
Author: xulab
Session Name: tps_P0_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1676 		1489132800 1676
Description:
Author: xulab
Session Name: tps_E16_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1633 		1489132800 1633
Description:
Author: xulab
Session Name: tps_E15_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1640 		1489132800 1640
Description:
Author: xulab
Session Name: tps_E14_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1641 		1489132800 1641
Description:
Author: xulab
Session Name: tps_ALL_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2377 		1489132800 2377
Description:
Author: ccornwel
Session Name: cfac
Genome Assembly: canFam3
Creation Date: 2016-09-26
Views: 1716 		1474876800 1716
Description:
Author: cocopow
Session Name: hg19-17q12
Genome Assembly: hg19
Creation Date: 2019-01-03
Views: 1520 		1546502400 1520
Description:
Author: rtmag4
Session Name: HCT116_ATAC_SEQ_TBLAB
Genome Assembly: hg38
Creation Date: 2017-03-03
Views: 1780 		1488528000 1780
Description:
Author: xulab
Session Name: tps_P0_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2047 		1489132800 2047
Description: Comparison of 7 primate genomes to the 2nd human chromosome.
Author: l.g.altizer
Session Name: 7Primate_Genomes
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 54 		1726560000 54
Description: Synteny and Conservation between Chimp and Human
Author: ALLDEREP
Session Name: Synteny and Conservation
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 42 		1726560000 42
Description:
Author: adriennelovett
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 1695 		1487923200 1695
Description:
Author: estercastillo
Session Name: AnaBelen_USalamanca_TP53
Genome Assembly: hg19
Creation Date: 2018-05-02
Views: 1705 		1525248000 1705
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_final_H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-02-17
Views: 1676 		1487318400 1676
Description:
Author: jberus
Session Name: Bio2010-JB
Genome Assembly: hg18
Creation Date: 2017-02-16
Views: 1647 		1487232000 1647
Description:
Author: SB
Session Name: hg38_ALK E20 Cas9
Genome Assembly: hg38
Creation Date: 2017-02-15
Views: 1793 		1487145600 1793
Description: We have recently released a file type called "longTabix" which supports inter & intra-chromosomal interactions by drawing an "arc" among paired regions in the UCSC Genome Browser. Note the first track at the top of the display, you can click on any of the "arcs" or interaction connections to see details such as ID and score. Credit goes to Cath Tyner for the creation of this session. Link to the original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ
Author: PublicSessions
Session Name: Viewing inter- & intra-chromosomal interactions
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1587 		1486972800 1587
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED
Genome Assembly: hg19
Creation Date: 2017-02-10
Views: 1598 		1486713600 1598
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED_autoscaled
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1642 		1486972800 1642
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_days_5_20_35_40
Genome Assembly: hg19
Creation Date: 2017-02-01
Views: 1644 		1485936000 1644
Description:
Author: thomas.sparks
Session Name: 181227-atac1-encode_dnase
Genome Assembly: mm10
Creation Date: 2018-12-27
Views: 1437 		1545897600 1437
Description:
Author: xrdong10
Session Name: hg19_fdek
Genome Assembly: hg19
Creation Date: 2017-01-24
Views: 1724 		1485244800 1724
Description:
Author: rikrdo89
Session Name: rna-seq cardiac
Genome Assembly: mm9
Creation Date: 2017-01-24
Views: 1688 		1485244800 1688
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1620 		1485158400 1620
Description:
Author: ryansamuel13
Session Name: TAS2R28 Gene
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1682 		1485158400 1682
Description:
Author: Shockwing
Session Name: South, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1642 		1484553600 1642
Description:
Author: ryansamuel13
Session Name: Samuel, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1583 		1484553600 1583
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test ALA
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1553 		1515398400 1553
Description:
Author: harri5al
Session Name: Spring18 Yeast Test (AH)
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1628 		1515398400 1628
Description:
Author: keitermd
Session Name: Spring17_Correct MOUSE TEST - MDK
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1822 		1483948800 1822
Description:
Author: khan2sa
Session Name: Spring17 Mouse test (SK)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1928 		1483948800 1928
Description:
Author: ryansamuel13
Session Name: Spring17 Worm test (RMS)
Genome Assembly: ce11
Creation Date: 2017-01-09
Views: 1632 		1483948800 1632
Description:
Author: keitermd
Session Name: Spring17 MOUSE TEST - MDK
Genome Assembly: mm10
Creation Date: 2017-01-09
Views: 1624 		1483948800 1624
Description:
Author: lesevimx
Session Name: Spring17 Mouse test (ML)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1599 		1483948800 1599
Description:
Author: idror
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-01-03
Views: 1841 		1483430400 1841
Description:
Author: yuelab
Session Name: mm9_min
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1697 		1484553600 1697
Description:
Author: warrenac
Session Name: GIT-mQTL-ASM
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 2061 		1475568000 2061
Description:
Author: jkearns94
Session Name: Fall 16 481 Final JK
Genome Assembly: mm9
Creation Date: 2016-12-12
Views: 1763 		1481529600 1763
Description:
Author: nightfury
Session Name: mm9-fam60a-de
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 1802 		1481443200 1802
Description: Since the reference genome assembly is a series of clone sequences from multiple individuals, and all individuals contain rare alleles, some of these rare alleles are included in reference assemblies. In this case, NM_001103170 (TGc), "c" mismatches the reference assemblies "A" because the reference sequence contains a substitution at this location. Please note that this example is on hg18, many (but not all) of these cases have been addressed in newer assemblies. AADACL3, in particular, does not have this substitution in GRCh38/hg38. Credit goes to Christopher Villarreal for creation of this session. Link to original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/6TG1Pze9rUI/TLsKg7bNAwAJ
Author: PublicSessions
Session Name: hg18.AADACL3_mRNA_discrepancy_vs_reference
Genome Assembly: hg18
Creation Date: 2016-12-09
Views: 1676 		1481270400 1676
Description:
Author: yezheng
Session Name: ATAC-seq_mm9_WT-+MU-+
Genome Assembly: mm9
Creation Date: 2019-01-31
Views: 1380 		1548921600 1380
Description:
Author: labrozam
Session Name: Labrozzi, Fall 17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-01
Views: 1522 		1506844800 1522
Description:
Author: cocopow
Session Name: hg19_bigBed12
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1362 		1553155200 1362
Description:
Author: suestring
Session Name: ???
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1326 		1552032000 1326
Description:
Author: suestring
Session Name: NotFusion
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1390 		1552032000 1390
Description:
Author: suestring
Session Name: 2
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1463 		1552032000 1463
Description:
Author: suestring
Session Name: 1
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1421 		1552032000 1421
Description:
Author: arem
Session Name: hg19 fin
Genome Assembly: hg19
Creation Date: 2019-02-21
Views: 1655 		1550736000 1655
Description:
Author: sureshpsbio
Session Name: mm10_Chip fam40
Genome Assembly: mm10
Creation Date: 2019-02-20
Views: 1805 		1550649600 1805
Description:
Author: ruhollah
Session Name: hg19_1600_chr1_nmt=20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1348 		1550649600 1348
Description:
Author: ruhollah
Session Name: hg19_844_chr7_nmt20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1308 		1550649600 1308
Description:
Author: ruhollah
Session Name: hg19_412Chr8_nmt19
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1919 		1550649600 1919
Description:
Author: ruhollah
Session Name: hg19_1148_chr1_nmt18
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1384 		1550649600 1384
Description:
Author: liaohy
Session Name: RNAseq_Liu.DY_AM20181126-13
Genome Assembly: mm10
Creation Date: 2019-12-31
Views: 1198 		1577779200 1198
Description:
Author: ruhollah
Session Name: hg19_986_chr3_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1447 		1554105600 1447
Description:
Author: ruhollah
Session Name: hg19_1305_chr16_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1319 		1554105600 1319
Description:
Author: ruhollah
Session Name: hg19_1388_chr1_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1567 		1554105600 1567
Description:
Author: ruhollah
Session Name: hg19_1136_chr17_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1344 		1554105600 1344
Description:
Author: ruhollah
Session Name: hg19_1373_chr19_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1332 		1554105600 1332
Description:
Author: ruhollah
Session Name: hg19_1044_chr2_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1393 		1554105600 1393
Description:
Author: ruhollah
Session Name: hg19_128_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1326 		1554105600 1326
Description:
Author: ruhollah
Session Name: hg19_511_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1545 		1554105600 1545
Description:
Author: ruhollah
Session Name: hg19_1111_chr9_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1381 		1554105600 1381
Description:
Author: ruhollah
Session Name: hg19_237_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1600 		1554105600 1600
Description:
Author: ruhollah
Session Name: hg19_1327_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1535 		1554105600 1535
Description:
Author: ruhollah
Session Name: hg19_40_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1600 		1554105600 1600
Description:
Author: ruhollah
Session Name: hg19_954_chr1_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1373 		1554105600 1373
Description:
Author: ruhollah
Session Name: hg19_1129_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1515 		1554105600 1515
Description:
Author: ruhollah
Session Name: hg19_960_chrX_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1470 		1554105600 1470
Description:
Author: ruhollah
Session Name: hg19_662_chr6_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1301 		1554105600 1301
Description:
Author: ruhollah
Session Name: hg19_876_chr17_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1327 		1554105600 1327
Description:
Author: ruhollah
Session Name: hg19_149_chr1_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1339 		1554105600 1339
Description:
Author: bashamal
Session Name: basham hg38 assignment 10/10
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1654 		1507536000 1654
Description:
Author: [email protected]
Session Name: mm10 celltype NTRK2
Genome Assembly: mm10
Creation Date: 2018-12-04
Views: 758 		1543910400 758
Screenshot not available
Click Here to view
 Description:
Author: Tao Zhang
Session Name: chicken transcriptome
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-29
Views: 2302 		1480406400 2302
Description:
Author: chkcole
Session Name: TN5_Prime_Alignments
Genome Assembly: hg38
Creation Date: 2017-10-24
Views: 2061 		1508832000 2061
Screenshot not available
Click Here to view
 Description:
Author: maria pia miano
Session Name: hg19s
Genome Assembly: hg19
Creation Date: 2016-11-16
Views: 1856 		1479283200 1856
Description:
Author: jtm
Session Name: shiny_app_mm10_v2
Genome Assembly: mm10
Creation Date: 2018-11-05
Views: 1686 		1541404800 1686
Description:
Author: headricn
Session Name: Fall16 481 final CH
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 1734 		1481443200 1734
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: AMD hg38 APOE SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1743 		1478246400 1743
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD CNN2 SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1764 		1478246400 1764
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD APOE SNP(CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1840 		1478246400 1840
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD SNPs
Genome Assembly: hg38
Creation Date: 2016-10-27
Views: 1779 		1477555200 1779
Description: This session highlights the differences in microRNA expression between endothelial cells and other primary cells types. The data in this session comes from the "Towards the human cellular microRNAome" public hub, created by Marc Halushka and Arun Patil at the Johns Hopkins Medical Institute.
Author: chmalee
Session Name: hg38_microRNA_cell_expression
Genome Assembly: hg38
Creation Date: 2017-09-11
Views: 2860 		1505116800 2860
Description:
Author: [email protected]
Session Name: MMR-branchpoints-260318
Genome Assembly: hg19
Creation Date: 2018-03-26
Views: 1605 		1522051200 1605
Description:
Author: rmaus
Session Name: nha_PE
Genome Assembly: mm8
Creation Date: 2016-10-18
Views: 1795 		1476777600 1795
Description:
Author: Sega666
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-19
Views: 1664 		1476864000 1664
Description:
Author: cath
Session Name: v339publicSessionTest
Genome Assembly: hg38
Creation Date: 2016-10-04
Views: 2085 		1475568000 2085
Screenshot not available
Click Here to view
 Description:
Author: Isilver1
Session Name: PCBP2_CLIP-seq_Reps1-3
Genome Assembly: mm10
Creation Date: 2017-03-28
Views: 1838 		1490688000 1838
Description:
Author: Sega666
Session Name: 02.11
Genome Assembly: hg19
Creation Date: 2016-11-02
Views: 1749 		1478073600 1749
Description:
Author: artman1967
Session Name: hg19_ATAC_2019
Genome Assembly: hg19
Creation Date: 2019-03-28
Views: 1435 		1553760000 1435
Description:
Author: mirigitik
Session Name: bahcc1
Genome Assembly: mm9
Creation Date: 2016-05-16
Views: 2146 		1463385600 2146
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech
Genome Assembly: hg19
Creation Date: 2016-09-14
Views: 1799 		1473840000 1799
Description:
Author: zxtzhangqian
Session Name: 3a-tet2
Genome Assembly: mm9
Creation Date: 2016-09-14
Views: 1730 		1473840000 1730
Description:
Author: vivekgopalanmedgenome
Session Name: hg19_panel_design_JRK
Genome Assembly: hg19
Creation Date: 2016-09-11
Views: 1789 		1473580800 1789
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech GenneReader
Genome Assembly: hg19
Creation Date: 2016-09-16
Views: 1725 		1474012800 1725
Description:
Author: sushivision
Session Name: TKNK31-090116
Genome Assembly: mm9
Creation Date: 2016-09-02
Views: 1656 		1472803200 1656
Screenshot not available
Click Here to view
 Description:
Author: [email protected]
Session Name: C2H2_type_1
Genome Assembly: hg19
Creation Date: 2016-09-01
Views: 1743 		1472716800 1743
Description:
Author: sambuca_shot
Session Name: mouse_reprog
Genome Assembly: mm10
Creation Date: 2016-03-23
Views: 1794 		1458720000 1794
Description: GTEx Allele Specific Expression hub from the Lappalainen Lab at the New York Genome Center. This session shows a region along chromosome 17 of high skin-specific allelic imbalance in a large number of Keratin genes.
Author: chmalee
Session Name: hg19KeratinAse
Genome Assembly: hg19
Creation Date: 2016-08-30
Views: 2757 		1472544000 2757
Description:
Author: pfiziev
Session Name: t_cell_development.H3K4me2 DECSTEP
Genome Assembly: mm9
Creation Date: 2016-08-26
Views: 2041 		1472198400 2041
Description:
Author: ps
Session Name: hg19.newTargets
Genome Assembly: hg19
Creation Date: 2016-08-26
Views: 1826 		1472198400 1826
Description: We sequenced the hermaphroditic freshwater snail, Biomphalaria glabrata (strain BB02), the host for the medically important trematode parasite, Schistosoma mansoni, using 1X coverage from plasmids and 0.1X BAC end sequencing on the ABI3730xl and 10X coverage sequenced on the Roche 454 Sequencer (including 2 paired end read runs) was initially assembled with Newbler. The Newbler assembly was screened for contamination then merged with a Soap assembly of Illumina reads followed by use of an in-house program for collapsing of redundant heterozygous contigs. Next, we applied our program, GapCloser, which closes gaps in the assembly by making iterative joins using Illumina reads. Finally we removed contigs less than 200 bases and incorporated reads into the assembly that had been assembled in a prior version of the Newbler assembly but were not assembled in this round. The resulting assembly, going by the name of assembly version 4.3, is 898.9Mb bases with an N50 contig length of 6.9kb and N50 scaffold length of 42kb. For creation of the linkage group AGP files, we identified all scaffolds that were uniquely placed on a single linkage group. Because of low marker density, only 145Mb was localized to specific linkage groups and scaffolds could not be ordered and oriented within linkage groups. Therefore, the scaffolds were simply placed in the order suggested by the linkage mapping on *_random for each linkage group. Credits: B. glabrata BB02 samples - Omar dos Santos Carvalho, Centro de Pesquisas Rene Rachou-Fiocruz (sample location: Barreiro, Brazil) BAC library - Coen M. Adema et al. (2006) Sequencing and Assembly - The Genome Institute, Washington University School of Medicine Linkage map - Jacob Tennessen and Michael Blouin, Oregon State University White Paper - Matty Knight et al (2003) Others - - Fred Lewis Biomedical Research Institute of the American Foundation of Biomedical Research - Eric Loker University of New Mexico Biology - Nithya Raghavan Biomedical Research Institute of the American Foundation of Biomedical Research
Author: lijing
Session Name: hub_107761_bioGla0
Genome Assembly: hub_107761_bioGla0
Creation Date: 2016-08-24
Views: 1885 		1472025600 1885
Description:
Author: elinshiao
Session Name: HEK293T_all
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1366 		1599465600 1366
Description:
Author: mperelis
Session Name: Stein_PDX1
Genome Assembly: mm10
Creation Date: 2016-09-30
Views: 1912 		1475222400 1912
Description:
Author: treparriscos
Session Name: Sara_poised_enhancers_1xnorm_mm10_2
Genome Assembly: mm10
Creation Date: 2016-06-03
Views: 1306 		1464940800 1306
Description:
Author: sappingtonae
Session Name: test
Genome Assembly: hg38
Creation Date: 2016-08-15
Views: 1946 		1471248000 1946
Description:
Author: yezheng
Session Name: ATAC-seq_mm9
Genome Assembly: mm9
Creation Date: 2018-01-22
Views: 2044 		1516608000 2044
Description:
Author: [email protected]
Session Name: Lidral, hg19, CL/P GWAS intervals
Genome Assembly: hg19
Creation Date: 2014-09-18
Views: 1574 		1411027200 1574
Description:
Author: shiguoming
Session Name: mm9_160812
Genome Assembly: mm9
Creation Date: 2016-08-11
Views: 1324 		1470902400 1324
Description:
Author: ykumar84
Session Name: mm10_Oct4
Genome Assembly: mm10
Creation Date: 2019-07-22
Views: 1558 		1563782400 1558
Description: This is an assembly hub for the AgamP4 assembly of Anopheles gambiae PEST strain. It includes the assembly; the coding genes and pseudogenes from vectorbase version 4.3; predicted stop codon readthrough regions; PhyloCSF tracks showing evolutionary protein-coding potential; splice-prediction tracks using the maximum-entropy splice-prediction algorithm; and novel coding and pseudogene predictions using PhyloCSF, excluding regions already annotated in vectorbase version 4.3.
Author: iljungr
Session Name: AgamP4
Genome Assembly: hub_102577_AgamP4
Creation Date: 2016-08-09
Views: 2312 		1470729600 2312
Description:
Author: brianlee
Session Name: mm9.RP23.470O14
Genome Assembly: mm9
Creation Date: 2016-08-03
Views: 1553 		1470211200 1553
Description:
Author: cocopow
Session Name: hub_1567195_araTha1_remap
Genome Assembly: hub_1567195_araTha1
Creation Date: 2019-09-04
Views: 1660 		1567584000 1660
Description:
Author: QAtester3
Session Name: ce11_ENCODE_hub
Genome Assembly: ce11
Creation Date: 2018-02-08
Views: 1468 		1518076800 1468
Description:
Author: QAtester3
Session Name: !@!$(GSDFG
Genome Assembly: galGal6
Creation Date: 2019-01-22
Views: 1475 		1548144000 1475
Description: This session of gene prediction tracks for "heart genes" uses the interact and bigGenePred formats to create decorations and the image of a heart. Read more about the interact format and bigGenePred formats from links on the Data File Formats help page under the Help menu and FAQs: http://genome.ucsc.edu/FAQ/FAQformat.html
Author: PublicSessions
Session Name: heart
Genome Assembly: hg38
Creation Date: 2019-02-11
Views: 4111 		1549872000 4111
Description:
Author: PublicSessions
Session Name: Tabula_muris
Genome Assembly: mm10
Creation Date: 2019-04-05
Views: 1458 		1554451200 1458
Description:
Author: cook2wj
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-22
Views: 1733 		1469174400 1733
Description:
Author: matthew.law
Session Name: MTAP_melanoma
Genome Assembly: hg19
Creation Date: 2016-07-25
Views: 1832 		1469433600 1832
Description:
Author: lesevimx
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-21
Views: 1771 		1469088000 1771
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP primers test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 2024 		1469088000 2024
Description:
Author: hadani81
Session Name: CGEMS Mouse HD/MC/JD Test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1647 		1469088000 1647
Description:
Author: Nithesh
Session Name: CGEMS Yeast NPC test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1730 		1469088000 1730
Description:
Author: monroejd
Session Name: CGEMS Yeast JM
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1686 		1469088000 1686
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1702 		1469088000 1702
Description:
Author: kapsakcj
Session Name: CGEMS Mouse CK test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1654 		1469088000 1654
Description:
Author: Shockwing
Session Name: CGEMS Yeast (Shockwing) Test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1893 		1469088000 1893
Description:
Author: herrsp
Session Name: CGEMS Yeast SPH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1711 		1469088000 1711
Description:
Author: blossta
Session Name: CGEMS Worm TB test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1730 		1469088000 1730
Description:
Author: shufengliu
Session Name: CGEMS Human SL test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1948 		1469088000 1948
Description:
Author: klj002
Session Name: CGEMS Worm (KLJ SFB) test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1699 		1469088000 1699
Description:
Author: MaxHenderson
Session Name: CGEMS Yeast MEH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1762 		1469088000 1762
Description:
Author: cook2wj
Session Name: CGEMS Human WCSK test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1641 		1469088000 1641
Description:
Author: bravonja
Session Name: CGEMS Human JBSP test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1713 		1469088000 1713
Description:
Author: stjacqrm
Session Name: CGEMS Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1719 		1469088000 1719
Description:
Author: s.jurg96
Session Name: CGEMS worm SJ EA CG test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1671 		1469088000 1671
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY Custom Tracks Chr6
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1752 		1469088000 1752
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1927 		1469088000 1927
Description:
Author: youngbh
Session Name: CGEMS Human BHY test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1803 		1469088000 1803
Description:
Author: youngbh
Session Name: CGEMS Worm BHY test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1678 		1469088000 1678
Description:
Author: dtautz
Session Name: wildmouse
Genome Assembly: mm10
Creation Date: 2016-07-26
Views: 2581 		1469520000 2581
Description:
Author: youngbh
Session Name: CGEMS Yeast BHY test
Genome Assembly: sacCer3
Creation Date: 2016-07-20
Views: 1739 		1469001600 1739
Description:
Author: arem
Session Name: colon methylation
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1411 		1551859200 1411
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: CGems Yeast AH test
Genome Assembly: sacCer3
Creation Date: 2016-07-19
Views: 1761 		1468915200 1761
Description:
Author: MWVermunt
Session Name: H3K27ac Human Brain, Vermunt et al (2014) Cell Reports
Genome Assembly: hg19
Creation Date: 2016-07-13
Views: 1997 		1468396800 1997
Description:
Author: pliu
Session Name: PRAM_master_set
Genome Assembly: hg38
Creation Date: 2019-01-04
Views: 1692 		1546588800 1692
Description:
Author: sajjeev
Session Name: comic sj15_22
Genome Assembly: hg19
Creation Date: 2019-01-04
Views: 1473 		1546588800 1473
Description:
Author: lijin
Session Name: session7 97L 3 chip
Genome Assembly: hg19
Creation Date: 2016-06-20
Views: 1992 		1466409600 1992
Description: This session displays the locations of significant SNPs from the GWAS for breast cancer DFS with P < 1 x 10-5 and eQTL-SNPs from GTEx portal with P < 1 × 10–10.
Author: Wen-Cheng
Session Name: rs1024176
Genome Assembly: hg19
Creation Date: 2018-05-25
Views: 1416 		1527235200 1416
Description: This session demonstrates the GTEx track on the human assembly hg19. The GTEx track shows data from the NIH Genotype-Tissue Expression project and displays expression data for each gene, based on GENCODE gene models, from 51 tissues collected from 570 individual. This session also demonstrates the gene-only mode of the multi-region feature, which removes intergenic regions from the display.
Author: mspeir
Session Name: hg19_gtexAnnouncement
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 1832 		1466150400 1832
Description: This session is demonstrating the exon-only mode of the multi-region feature. The exon-only mode uses the GENCODE v22 track to slice up the normal display and remove both intronic and intergenic regions from the display. Only those regions covered by exons, both coding and noncoding, are left in the display. For more on the multi-region display see the user guide: http://genome.ucsc.edu/goldenPath/help/multiRegionHelp.html.
Author: mspeir
Session Name: hg38_exonOnlyExample
Genome Assembly: hg38
Creation Date: 2016-06-17
Views: 1732 		1466150400 1732
Description:
Author: mspeir
Session Name: hg19_CAGrepeat
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 1799 		1466150400 1799
Description: Public session showcasing the GTEx gene expression track and GTEx RNA-seq signal hub for the <a target=_blank href='http://genome.ucsc.edu/blog/gtex-resources-in-the-browser/'>GTEx Resources in the Browser</a> GB blog article. The session shows a genomic region with 5 genes with different patterns of tissue-specific expression.
Author: kate
Session Name: GTEx demo for blog (long, with error)
Genome Assembly: hg19
Creation Date: 2016-06-09
Views: 3928 		1465459200 3928
Description:
Author: ruhollah
Session Name: hg19_681_chr15_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1504 		1554105600 1504
Description: Session highlights a mouse-specific repeat on chromosome 12. You can see the gap in the 60-way vertebrate alignment surrounding the repeat, which is highlighted in light blue. The repeat is classified as a LINE and is part of the L1 family of repeats. Additionally, on the far right-hand side of the display, you can see the retrotransposed Bf3 gene.
Author: mspeir
Session Name: mm10_MouseSpecificRepeat_plus_RetroposedGene
Genome Assembly: mm10
Creation Date: 2016-05-24
Views: 1618 		1464076800 1618
Description: Session displays the promoter region of DARC on human assembly hg19 including UCSC Genes, dbSNP 146 (Common subset) and the Publications track showing sequences and SNPs text-mined from PubMed Central and Elsevier. Adapted from Figure 1 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig1
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 1795 		1464076800 1795
Description: Session displays the dyskeratosis congenita 1 (DKC1) gene using the exon-only multi-region mode in the human assembly hg38. Alongside the gene structure, tracks displaying dbSNP "flagged" variants, OMIM clinical variants, ENCODE transcription levels from 9 cell lines, a 100-way vertebrate alignment (only a subset of species displayed), and conservation scores calculated using phyloP across this 100-way alignment.
Author: mspeir
Session Name: hg38_DKC1_SNPs_Cons_Transcription
Genome Assembly: hg38
Creation Date: 2016-05-24
Views: 1732 		1464076800 1732
Description: Session displays the promoter region and transcription start of IRF1 on human assembly hg19 showing UCSC Genes, 1000 Genomes Phase 3 Integrated Variant Calls in the haplotype sorting VCF display mode, histone mark H3K27Ac binding in overlays of 7 ENCODE cell lines and PhyloP conservation scores from alignments of 100 vertebrates. Adapted from Figure 2 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig2
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 1862 		1464076800 1862
Description:
Author: as00419
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1392 		1557388800 1392
Description:
Author: lijin
Session Name: session2 four types
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 2423 		1460880000 2423
Description:
Author: lijin
Session Name: session5 whole genome methy
Genome Assembly: hg19
Creation Date: 2016-04-29
Views: 1870 		1461916800 1870
Description:
Author: leipinji
Session Name: hg19-HCT116-liyiming
Genome Assembly: hg19
Creation Date: 2016-04-12
Views: 1590 		1460448000 1590
Description:
Author: Julia H-Z
Session Name: Cancer Cell Tracks
Genome Assembly: hg19
Creation Date: 2019-02-19
Views: 1438 		1550563200 1438
Description:
Author: Julia H-Z
Session Name: CC Tracks 2
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1392 		1550649600 1392
Description:
Author: jdf228
Session Name: PGC-1 alpha ChIP-seq C2C12
Genome Assembly: mm9
Creation Date: 2017-03-20
Views: 1875 		1489996800 1875
Description:
Author: gunasekaran
Session Name: Gunasekaran_Dhandapani_UCSC_mm10
Genome Assembly: mm10
Creation Date: 2019-02-07
Views: 1334 		1549526400 1334
Description:
Author: ascendgene
Session Name: 60genes panel chr1
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1696 		1532505600 1696
Description:
Author: peijinlim
Session Name: mm9 nrf2chipseq tracks
Genome Assembly: mm9
Creation Date: 2016-10-19
Views: 1767 		1476864000 1767
Description:
Author: SCRB20
Session Name: SCRB20_GOOD
Genome Assembly: hg19
Creation Date: 2016-03-21
Views: 1614 		1458547200 1614
Description:
Author: msantos.13
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-06
Views: 1382 		1549440000 1382
Description:
Author: janzop
Session Name: mm9_HBx-RFP
Genome Assembly: mm9
Creation Date: 2016-09-27
Views: 1519 		1474963200 1519
Description:
Author: lijin
Session Name: session1 Liver 97L exp meth
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 1802 		1460880000 1802
Description:
Author: labrozam
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2016-10-02
Views: 2144 		1475395200 2144
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp Assignement
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1497 		1507622400 1497
Description:
Author: kianoush
Session Name: Panels
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1198 		1551859200 1198
Description:
Author: arem
Session Name: hg19_chr10_Human
Genome Assembly: hg19
Creation Date: 2019-03-08
Views: 1348 		1552032000 1348
Description:
Author: ephong0305
Session Name: KSG GWAS IA chr1_22 v1
Genome Assembly: hg19
Creation Date: 2021-07-30
Views: 823 		1627632000 823
Description:
Author: dunlapea
Session Name: Dunlap, BIO480 Uba1 example
Genome Assembly: hg19
Creation Date: 2016-09-04
Views: 1766 		1472976000 1766
Description:
Author: cocopow
Session Name: hg19epigenetics_WASHU_VizHub
Genome Assembly: hg19
Creation Date: 2019-02-07
Views: 1448 		1549526400 1448
Description:
Author: harri5al
Session Name: CGEMS yeast (AH) test
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1750 		1515398400 1750
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test Abraham
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1562 		1515398400 1562
Description:
Author: nedaronaghi
Session Name: hg19-all_weeks
Genome Assembly: hg19
Creation Date: 2017-03-07
Views: 1736 		1488873600 1736
Description:
Author: Natedawg34
Session Name: fall17 bio630 human NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1548 		1505289600 1548
Description:
Author: Natedawg34
Session Name: Fall 2017 Bio 630 NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1510 		1505289600 1510
Description:
Author: stjacqrm
Session Name: Fall17 Bio630 Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2017-09-13
Views: 1528 		1505289600 1528
Description:
Author: alexc
Session Name: MitoGenome Analysis
Genome Assembly: hg38
Creation Date: 2016-05-17
Views: 1574 		1463472000 1574
Description:
Author: Natedawg34
Session Name: Miller, Fall17, Uba1
Genome Assembly: mm10
Creation Date: 2017-09-12
Views: 1570 		1505203200 1570
Description:
Author: alexc
Session Name: ARUP_cyto
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1956 		1543219200 1956
Description: chr2
Author: diazacex
Session Name: Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 37 		1726560000 37
Description:
Author: leipinji
Session Name: hg19-HCT16-H3K27ac-P53-EP300
Genome Assembly: hg19
Creation Date: 2015-10-22
Views: 1674 		1445500800 1674
Description:
Author: hfw824
Session Name: Dou_LADs IgHV
Genome Assembly: hg19
Creation Date: 2015-10-20
Views: 1890 		1445328000 1890
Description:
Author: delphine.rolando10
Session Name: hg19_HI-LNCs_UCSCsession
Genome Assembly: hg19
Creation Date: 2016-11-01
Views: 1770 		1477987200 1770
Screenshot not available
Click Here to view
 Description:
Author: wentao li
Session Name: 2CPD and 64 NT2
Genome Assembly: hg19
Creation Date: 2015-10-06
Views: 1533 		1444118400 1533
Description:
Author: leipinji
Session Name: hg19-hct116-LYM-RNASeq
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 1737 		1507190400 1737
Description:
Author: lianeslaughter
Session Name: mm9-H4K16acRestored
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 2003 		1506412800 2003
Description:
Author: [email protected]
Session Name: evo mels hg19 TFAP2A in hNCC
Genome Assembly: hg19
Creation Date: 2014-05-29
Views: 1297 		1401350400 1297
Description:
Author: GenePeeks
Session Name: .2017.10 Haplotype & HGDP
Genome Assembly: hg19
Creation Date: 2017-10-06
Views: 1855 		1507276800 1855
Screenshot not available
Click Here to view
 Description:
Author: jcasper
Session Name: bedtoolsvssamtools
Genome Assembly: hg18
Creation Date: 2014-05-27
Views: 1732 		1401177600 1732
Description:
Author: jverploegen
Session Name: GHE sequencing steroids
Genome Assembly: hg19
Creation Date: 2017-10-10
Views: 1717 		1507622400 1717
Description:
Author: hs523
Session Name: mm10-ZFP57-SentToAnastasia-merged
Genome Assembly: mm10
Creation Date: 2016-01-13
Views: 1816 		1452672000 1816
Description:
Author: GenePeeks
Session Name: .2017 Zoomed-in View 1
Genome Assembly: hg19
Creation Date: 2017-10-09
Views: 1510 		1507536000 1510
Description:
Author: taly
Session Name: EnhancerPrediction
Genome Assembly: dm3
Creation Date: 2017-10-10
Views: 1638 		1507622400 1638
Description:
Author: rhead
Session Name: 450k.EPIC.beadchip
Genome Assembly: hg19
Creation Date: 2016-11-06
Views: 1825 		1478419200 1825
Description: This mailing question allows one to see how you can color the current DNA with data from tracks such as SNP tracks. Load the session, then type "v d" or go to the View menu and then select DNA.<br> Once you are on the "Get DNA for" page do not click "get DNA" rather click the <b>'extended case/color options'</b> button and get Extended DNA Case/Color Output with DNA colored per the SNP tracks (150 in this case) or choose other tracks. <b>Note</b> that the All SNPs are Italic and Blue and the Common SNPs are Bold and Red and when they are both the colors and style combine.
Author: brianlee
Session Name: hg19.MLQ_20306
Genome Assembly: hg19
Creation Date: 2017-10-11
Views: 1645 		1507708800 1645
Description:
Author: [email protected]
Session Name: eliz leslie hg19
Genome Assembly: hg19
Creation Date: 2014-01-17
Views: 1292 		1389945600 1292
Description: This is a session with some highlights.
Author: brianlee
Session Name: moreHighlights
Genome Assembly: hg38
Creation Date: 2019-05-07
Views: 1308 		1557216000 1308
Description:
Author: josoga2
Session Name: chromHmm
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1219 		1591689600 1219
Description: nar
Author: as00419
Session Name: example
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1357 		1557388800 1357
Description:
Author: ccpowell
Session Name: 50120_solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-07
Views: 1203 		1588838400 1203
Description:
Author: bashamal
Session Name: hg38 chr2 comparison 10/10 in class
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1553 		1507622400 1553
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_hotspots_131686
Genome Assembly: hg19
Creation Date: 2017-10-19
Views: 1585 		1508400000 1585
Description:
Author: cocopow
Session Name: hg18_44way_bed
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1280 		1563955200 1280
Description:
Author: wenzelmk
Session Name: BIO481 Mouse (Wenzel & Zeher) test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1443 		1507190400 1443
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1508 		1507190400 1508
Description:
Author: herdaj
Session Name: Bio481 Human Herd Test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1673 		1507190400 1673
Description:
Author: labrozam
Session Name: Bio481 Human Labrozzi-Grant test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1532 		1507190400 1532
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Test
Genome Assembly: sacCer3
Creation Date: 2017-10-05
Views: 1540 		1507190400 1540
Description: This session shows the Integrative and Discriminative Epigenome Annotation System (IDEAS) Public Hub, which has data for inferred chromatin states in 127 cell types. A color key for each state is shown near a heatmap on the Track Description page, also found in the related journal <a href="https://academic.oup.com/view-large/figure/97265435/gkx659fig1.jpg/Accurate%20and%20reproducible%20functional%20maps%20in%20127%20human%20cell%20types%20via%202D%20genome%20segmentation">figure 1</a>. This session has some segmentation examples by IDEAS and ChromHMM in HSC and B-cell cell types (9 total) near genes CIITA and CLEC16A. Find more reference information on the Track Description page or at this <a href="https://doi.org/10.1093/nar/gkx659">journal article</a>. The IDEAS algorithm is available on GitHub at <a href="https://github.com/yuzhang123/IDEAS">https://github.com/yuzhang123/IDEAS</a>.
Author: brianlee
Session Name: hg19.IDEAS.hub
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 1957 		1507190400 1957
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_Pancreas_131774
Genome Assembly: hg19
Creation Date: 2017-10-22
Views: 1552 		1508659200 1552
Description:
Author: hujian5241
Session Name: fly_dh1_dm3_bw
Genome Assembly: dm3
Creation Date: 2017-11-13
Views: 1503 		1510560000 1503
Description:
Author: simonwang612
Session Name: Methylation
Genome Assembly: mm10
Creation Date: 2020-07-25
Views: 1614 		1595664000 1614
Description:
Author: anneabraham1
Session Name: Abraham, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-13
Views: 1705 		1515830400 1705
Description:
Author: [email protected]
Session Name: Ruchi tracks hg19
Genome Assembly: hg19
Creation Date: 2014-01-27
Views: 1320 		1390809600 1320
Description:
Author: twx123
Session Name: PTC-mm9-newest
Genome Assembly: mm9
Creation Date: 2015-06-10
Views: 1404 		1433923200 1404
Description:
Author: cocopow
Session Name: hg38_chr17_KCNJ18
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1554 		1551945600 1554
Description:
Author: [email protected]
Session Name: mm9 visel enhancers
Genome Assembly: mm9
Creation Date: 2014-01-11
Views: 1387 		1389427200 1387
Description:
Author: Shirley
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2018-11-20
Views: 1240 		1542700800 1240
Description:
Author: QAtester
Session Name: 111hg38
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1781 		1545379200 1781
Description:
Author: Boonede
Session Name: MAPT_DougBoone
Genome Assembly: hg38
Creation Date: 2019-03-11
Views: 1385 		1552291200 1385
Description:
Author: Guillermo6
Session Name: hg19_ashg2014_SNPs
Genome Assembly: hg19
Creation Date: 2017-11-01
Views: 1678 		1509523200 1678
Description:
Author: ferhatay
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-08-25
Views: 1697 		1472112000 1697
Description:
Author: kkarri
Session Name: rn6_transcriptome
Genome Assembly: rn6
Creation Date: 2017-10-27
Views: 1655 		1509091200 1655
Description:
Author: wangt5
Session Name: HBEC_VitD
Genome Assembly: hg19
Creation Date: 2017-11-15
Views: 1515 		1510732800 1515
Description:
Author: bashamal
Session Name: Basham, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1539 		1506931200 1539
Description:
Author: cocapo
Session Name: ponAbe3_BTN1A1
Genome Assembly: ponAbe3
Creation Date: 2018-11-15
Views: 1639 		1542268800 1639
Description:
Author: lbenner
Session Name: Sxl
Genome Assembly: dm6
Creation Date: 2016-10-22
Views: 1926 		1477123200 1926
Description:
Author: macdonem
Session Name: Old AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1539 		1509436800 1539
Description:
Author: macdonem
Session Name: New AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1552 		1509436800 1552
Description:
Author: falbert
Session Name: FP_sacCer3
Genome Assembly: sacCer3
Creation Date: 2013-08-07
Views: 1550 		1375862400 1550
Description:
Author: ruhollah
Session Name: hg19_94Chr12_28
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1547 		1543219200 1547
Description: EEPD1 ChIP-seq on chromosome 1 hg38
Author: abacolla
Session Name: eepd1_chr1
Genome Assembly: hg38
Creation Date: 2023-05-30
Views: 344 		1685433600 344
Description:
Author: cocopow
Session Name: hg38_ RepeatMasker
Genome Assembly: hg38
Creation Date: 2019-01-24
Views: 1483 		1548316800 1483
Description:
Author: kkaczor
Session Name: cirm_ucla
Genome Assembly: hg38
Creation Date: 2020-11-12
Views: 1120 		1605168000 1120
Description:
Author: cocopow
Session Name: hg38_tf _pc
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1311 		1560240000 1311
Description:
Author: cocopow
Session Name: hg38_tf_pc2
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1264 		1560240000 1264
Description:
Author: cocopow
Session Name: hg19_myc+ctcf
Genome Assembly: hg19
Creation Date: 2019-06-11
Views: 1445 		1560240000 1445
Description:
Author: cocopow
Session Name: hg38_myc+ctcf
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1458 		1560240000 1458
Description:
Author: dtautz
Session Name: wildmouse-introgression
Genome Assembly: mm10
Creation Date: 2017-11-04
Views: 1618 		1509782400 1618
Description:
Author: lijin
Session Name: session4 plus h3k27ac density andpeaks
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 1743 		1461830400 1743
Description:
Author: lijin
Session Name: session3 plus h3k27ac
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 1773 		1461830400 1773
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1640 		1508227200 1640
Description:
Author: XiangChen
Session Name: Bio481 Chen Gzmm CBRs in Mice Photoreceptors
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1494 		1510905600 1494
Description: This session illustrates how a user was having a hard time aligning the cDNA sequence with their Predicted Protein. They were manually using DNA sequence to make a triplet number to figure out codon numbering. The session shows how when zoomed in on the base level, if you right click the top Base Position track and set it to display in "full" you will see predicted proteins for every set of codons across the genome. This particular session at the start of the SIRT1 gene is also displaying the conservation tracks with similar coding information for several species. This information is also available in the table browser, where you can select output as "sequence" for a genomic region when you select a gene's track table as the source.
Author: brianlee
Session Name: exampleProteinGene
Genome Assembly: hg19
Creation Date: 2013-08-23
Views: 230 		1377244800 230
Description: HBB on hg38 with single cell Heart and Merged data
Author: ashg2023
Session Name: hg38_HBB_singleCell1
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 253 		1691049600 253
Description: Hemoglobin beta 3 isoforms displayed, snp155 Common turned on.
Author: ashg2023
Session Name: hg38_HBB_snp155
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 260 		1691049600 260
Description:
Author: jwjiao
Session Name: E13-forebrain-H3K36me3-ChIP
Genome Assembly: mm10
Creation Date: 2017-11-06
Views: 1701 		1509955200 1701
Description:
Author: ruhollah
Session Name: hg19_45Chr3_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1380 		1543305600 1380
Description:
Author: ruhollah
Session Name: hg19_56Chr19_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1371 		1543305600 1371
Description:
Author: isilver1
Session Name: PABPC1_CLIP_Public
Genome Assembly: mm10
Creation Date: 2015-07-01
Views: 2287 		1435737600 2287
Description:
Author: xiaotiao
Session Name: 4CProject
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1311 		1552636800 1311
Description:
Author: zhangjing12
Session Name: 201901-ATAC seq
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1370 		1552636800 1370
Description: human chr.2 synteny to other primates
Author: marte2je
Session Name: hg38 to other primates - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 39 		1726560000 39
Description: 9/17/24
Author: aehodges
Session Name: hg38 chromosome 2/Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 26 		1726560000 26
Description:
Author: hujian5241
Session Name: fly_dh1_dm3
Genome Assembly: dm3
Creation Date: 2017-11-12
Views: 1488 		1510473600 1488
Description:
Author: salima
Session Name: e32_tailseq_5p_3p
Genome Assembly: ce10
Creation Date: 2015-07-03
Views: 1988 		1435910400 1988
Description: This session was used to answer a mailing list question about mm9.retina data. You can see how the signal data was processed to create finalized peaks.
Author: brianlee
Session Name: mm9.retina
Genome Assembly: mm9
Creation Date: 2017-11-14
Views: 1535 		1510646400 1535
Description:
Author: keitermd
Session Name: Keiter, Spring 2017, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-15
Views: 1579 		1484467200 1579
Description:
Author: aurbanow
Session Name: srivatsan
Genome Assembly: hg38
Creation Date: 2020-12-28
Views: 1248 		1609142400 1248
Description:
Author: nicklewis
Session Name: photoreceptor sesh
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1629 		1510819200 1629
Description:
Author: nicklewis
Session Name: photorecptor session
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1542 		1510819200 1542
Description:
Author: nrhong
Session Name: hg38_KIAA1217
Genome Assembly: hg38
Creation Date: 2018-01-25
Views: 1559 		1516867200 1559
Description:
Author: labrozam
Session Name: wt/Nrl-
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1533 		1510905600 1533
Description:
Author: german.n
Session Name: zebrafish_Iso-Seq
Genome Assembly: danRer10
Creation Date: 2018-03-16
Views: 1545 		1521187200 1545
Description:
Author: ruhollah
Session Name: hg19_1220_chr3_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1513 		1554105600 1513
Description:
Author: Yog77
Session Name: chrMT_rCRS_NC012920
Genome Assembly: hg19
Creation Date: 2020-05-20
Views: 1169 		1589961600 1169
Description:
Author: timmnat
Session Name: Figure4-Differences_in_polymorphism_frequency_and_copy number.hub_1106737_Amex_PQ.v4
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-09-13
Views: 1456 		1599984000 1456
Description:
Author: [email protected]
Session Name: mm9 Loftus/Pavan Tfap2a
Genome Assembly: mm9
Creation Date: 2014-06-23
Views: 1295 		1403510400 1295
Description:
Author: [email protected]
Session Name: tfap2a in Ncc, MITF hg18
Genome Assembly: hg18
Creation Date: 2014-09-30
Views: 1382 		1412064000 1382
Description:
Author: grant2jm
Session Name: Grant, Fall 17, allignment example
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1489 		1507536000 1489
Description:
Author: katiegal
Session Name: Lhx3-Isl1-p53
Genome Assembly: mm9
Creation Date: 2014-10-01
Views: 1162 		1412150400 1162
Description:
Author: mattievaz8
Session Name: 062816_Mattie
Genome Assembly: mm10
Creation Date: 2016-06-28
Views: 1773 		1467100800 1773
Description:
Author: nicklewis
Session Name: Lewis Fall17 Uba1
Genome Assembly: mm9
Creation Date: 2017-10-03
Views: 1582 		1507017600 1582
Description:
Author: holtonke
Session Name: CGEMS Worm KEH test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1767 		1469088000 1767
Description:
Author: alyssa
Session Name: Ayala-Ps2-ACE2-session
Genome Assembly: hg19
Creation Date: 2020-05-07
Views: 1475 		1588838400 1475
Description:
Author: yierjin_2008
Session Name: MMCL.H3K27ac.SEs
Genome Assembly: hg19
Creation Date: 2017-11-10
Views: 1698 		1510300800 1698
Description:
Author: ruhollah
Session Name: hg19_72Chr14_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1868 		1543219200 1868
Description:
Author: ShiyiYin
Session Name: mega data with coordinations
Genome Assembly: hg19
Creation Date: 2017-02-08
Views: 1772 		1486540800 1772
Description:
Author: ShiyiYin
Session Name: intron6 ehf pcr
Genome Assembly: hg19
Creation Date: 2017-01-27
Views: 1772 		1485504000 1772
Description: This session highlights the "Seq-data on mm9 NS5 cells" public hub, where Juan Mateo et al. assayed crucial transcription factor binding activity forming the basis of the neural stem cell self-renewal regulatory network.
Author: chmalee
Session Name: mm9_NS5_Cell_Expression
Genome Assembly: mm9
Creation Date: 2017-11-28
Views: 2055 		1511856000 2055
Description:
Author: grant2jm
Session Name: Grant, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1461 		1506931200 1461
Description:
Author: isilver1
Session Name: NAD
Genome Assembly: mm10
Creation Date: 2015-03-09
Views: 1837 		1425888000 1837
Description:
Author: ruhollah
Session Name: 1_50_outliers_hg19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1684 		1543219200 1684
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq BCL2
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1286 		1547625600 1286
Description:
Author: mspeir
Session Name: hg19_wobble
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 2346 		1466150400 2346
Description:
Author: [email protected]
Session Name: example1
Genome Assembly: hg19
Creation Date: 2017-11-13
Views: 1824 		1510560000 1824
Description:
Author: puertoRico2019
Session Name: DQP
Genome Assembly: hg19
Creation Date: 2019-04-12
Views: 1252 		1555056000 1252
Description:
Author: mziegler
Session Name: encode_Accessibility+TAD
Genome Assembly: hg19
Creation Date: 2018-09-11
Views: 1434 		1536652800 1434
Description:
Author: cath
Session Name: v338test
Genome Assembly: hg38
Creation Date: 2016-09-13
Views: 1690 		1473753600 1690
Description:
Author: josoga2
Session Name: joseph_omix_hw
Genome Assembly: mm10
Creation Date: 2020-05-19
Views: 1164 		1589875200 1164
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Custom Track
Genome Assembly: mm9
Creation Date: 2017-10-17
Views: 1513 		1508227200 1513
Description:
Author: nicklewis
Session Name: CGEMS Yeast Test - Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1531 		1508227200 1531
Description:
Author: herdaj
Session Name: Bio481 Human Custom Herd
Genome Assembly: hg38
Creation Date: 2017-10-17
Views: 1804 		1508227200 1804
Description:
Author: erick.gabriel
Session Name: MYBPC1 alleles
Genome Assembly: hg19
Creation Date: 2018-09-07
Views: 1459 		1536307200 1459
Description: This example session shows some selected cell lines displayed with DNaseI tracks available for the mm9 mouse assembly from the ENCODE project. You can click the grey bars at the far left to go to the track descriptions, and select even more cell types. This session is the result of a user requesting where to find known areas/regions of chromatin in the mouse genome, especially condensed regions of DNA. By entering the user's coordinates of interest the researcher could investigate data indicating hypersensitive DNase regions.
Author: brianlee
Session Name: DNase in mm9 Example
Genome Assembly: mm9
Creation Date: 2013-07-30
Views: 240 		1375171200 240
Description:
Author: ruhollah
Session Name: hg19_209Chr7_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1390 		1547452800 1390
Description:
Author: marzoldr
Session Name: Marzolf, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-17
Views: 1450 		1516176000 1450
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. In this display, a highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancer
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1285 		1553846400 1285
Description:
Author: ferrerjm
Session Name: Ferrer, FALL17, yeast custom track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 2099 		1508227200 2099
Description: This session displays a region of the LHX6 gene that highlights a selection of the new tracks added in the previous year for the hg38/GRCh38 human assembly. The tracks shown in this display (from top to bottom) include GENCODE Genes V22, transcription levels assayed across 9 ENCODE cell lines, DNase hypersensitive regions based on data from 95 ENCODE cell lines, genome-wide conservation scores calculated using phastCons, a multiple genome alignment created using Lastz and Multiz, and pathogenic CNVs from the ClinGen database. Adapted from Figure 1 in Speir, et al. The UCSC Genome Browser database: 2016 update. Nucleic Acids Res. 2016 Jan 4;44(D1):D717-25: http://nar.oxfordjournals.org/content/44/D1/D717.full
Author: mspeir
Session Name: hg38_NAR_2016_Fig1
Genome Assembly: hg38
Creation Date: 2015-08-11
Views: 1922 		1439280000 1922
Description:
Author: ruhollah
Session Name: hg19_1_chr15
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1491 		1543219200 1491
Description:
Author: ruhollah
Session Name: hg19_4_chr3
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1420 		1543219200 1420
Description:
Author: ruhollah
Session Name: hg19_3_chr14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1369 		1543219200 1369
Description:
Author: ruhollah
Session Name: hg19_22Chr19_nmt32
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1499 		1543219200 1499
Description:
Author: ruhollah
Session Name: hg19_25Chr5_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1353 		1543219200 1353
Description:
Author: ruhollah
Session Name: hg19_69Chr1_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1385 		1543219200 1385
Description:
Author: ruhollah
Session Name: hg19_17Chr3_nmt26
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1371 		1543219200 1371
Description:
Author: Atma
Session Name: hervh-MYO16
Genome Assembly: hg38
Creation Date: 2019-01-22
Views: 1702 		1548144000 1702
Description: This browsing started on hg38, and then the region was lifted to hg19, and then the TFBS track turned on to show how some histone activity is related to TFBS that aren't seen on hg38 because the track isn't available there.
Author: brianlee
Session Name: hg19_MTOR
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1387 		1548144000 1387
Description:
Author: ruhollah
Session Name: hg19_47Chr14_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1375 		1543219200 1375
Description:
Author: ruhollah
Session Name: hg19_55Chr21_nmt19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1344 		1543219200 1344
Description:
Author: ruhollah
Session Name: hg19_46ChrX_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1914 		1543219200 1914
Description:
Author: ruhollah
Session Name: hg19_31Chr22_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1357 		1543219200 1357
Description:
Author: ruhollah
Session Name: hg19_37Chr1_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1484 		1543219200 1484
Screenshot not available
Click Here to view
 Description:
Author: ruhollah
Session Name: hg19_18Chr17_21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1419 		1543219200 1419
Description:
Author: ruhollah
Session Name: hg19_16Chr5_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1706 		1543219200 1706
Description:
Author: ruhollah
Session Name: hg19_12Chr3_nmt22
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1454 		1543219200 1454
Description:
Author: ruhollah
Session Name: hg19_95Chr16_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1358 		1543219200 1358
Description:
Author: kinerettaler
Session Name: danRer11_plod3+-100,000
Genome Assembly: danRer11
Creation Date: 2018-12-25
Views: 1315 		1545724800 1315
Description:
Author: ruhollah
Session Name: hg19_26Chr17_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1343 		1543219200 1343
Description:
Author: xiaotiao
Session Name: txiao
Genome Assembly: hg19
Creation Date: 2019-03-13
Views: 1397 		1552464000 1397
Description:
Author: ruhollah
Session Name: hg19_70Chr6_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1536 		1543219200 1536
Description:
Author: ldistefano
Session Name: dm6_LDiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1357 		1552377600 1357
Description:
Author: marylaws
Session Name: hg18 Mol Biol Cell 2013 Grant GD
Genome Assembly: hg18
Creation Date: 2017-11-06
Views: 1772 		1509955200 1772
Description: Acinetobacter baumannii ATCC 17978 UN
Author: Ab17978Cook
Session Name: GCF_019356215.1
Genome Assembly: hub_3861787_GCF_019356215.1
Creation Date: 2023-01-12
Views: 315 		1673510400 315
Description:
Author: ruhollah
Session Name: hg19_75Chr7_nmt16
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1386 		1543219200 1386
Description:
Author: ruhollah
Session Name: hg19_40Chr22_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1407 		1543305600 1407
Description:
Author: ruhollah
Session Name: hg19_49Chr3_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1360 		1543305600 1360
Description:
Author: ruhollah
Session Name: hg19_58Chr1_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1373 		1543305600 1373
Description:
Author: ruhollah
Session Name: hg19_89Chr5_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1432 		1543305600 1432
Description:
Author: kazuhidew
Session Name: hg38_NAR_submission
Genome Assembly: hg38
Creation Date: 2018-11-28
Views: 1492 		1543392000 1492