Public Sessions
 

Sessions allow users to save snapshots of the Genome Browser and its current configuration, including displayed tracks, position, and custom track data. The Public Sessions tool allows users to easily share those sessions that they deem interesting with the rest of the world's researchers. You can add your own sessions to this list by checking the appropriate box on the Session Management page.

See the Sessions User's Guide for more information.

Sort by:

Screenshot Session Properties Creation Date Use Count
Description: yes
Author: aryanzandi123
Session Name: Core Chromatin State Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 99
1733904000 99
Description: CTCF and SMC1 ChIP-seq data for Crewe et al submission to NAR
Author: Morgan.Crewe
Session Name: NAR_CTCF_SMC1_Data
Genome Assembly: mm10
Creation Date: 2024-12-10
Views: 107
1733817600 107
Description: A new study in Nature reveals how the absence of a small gene segment due to alternative splicing in CPEB4 leads to the deregulation of 200 genes associated with autism spectrum disorders: https://www.nature.com/articles/s41586-024-08289-w An earlier work by the same authors identified this mRNA as a factor in the autism-like phenotype: https://www.nature.com/articles/s41586-018-0423-5 The work took place at IRB Barcelona: https://www.irbbarcelona.org/en/news/scientific/key-breakthrough-autism-pivotal-role-cpeb4-condensates-revealed: “Our results suggest that even small decreases in the percentage of microexon inclusion can have significant effects. This would explain why some individuals without a gene mutation develop idiopathic autism.” UCSC Genome Browser Session
Author: brianlee
Session Name: CPEB4_GCAAGGACATATGGGCGAAGGAGA
Genome Assembly: hg38
Creation Date: 2024-12-05
Views: 37
1733385600 37
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2025_fig5
Genome Assembly: hg19
Creation Date: 2024-12-04
Views: 192
1733299200 192
Description: 12
Author: aryanzandi123
Session Name: Core Chromatin State Window 2.0
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 21
1733904000 21
Description: te
Author: aryanzandi123
Session Name: Alternate Repressors and Activators Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 22
1733904000 22
Description: 15 stae ChromHMM model of MSC,PC,HC based on murine data and on a human ChromHMM model. (Neu et al. 2024)
Author: [email protected]
Session Name: murine and humanized ChromHMM model
Genome Assembly: mm39
Creation Date: 2024-11-15
Views: 545
1731657600 545
Description: GFP+ ChIP-Seq data
Author: nimt0001
Session Name: GFP+ ChIP-Seq
Genome Assembly: danRer10
Creation Date: 2024-11-13
Views: 458
1731484800 458
Description: Forebrain Enhancers Track Hub Description From cellular differentiation to organismal development, the spatiotemporal expression of tissue-specific genes is driven by regulatory DNA elements. Among these, enhancers—also referred to as distal-acting cis-regulatory modules (CRMs)—are essential for increasing gene expression. Enhancers are cis-acting DNA sequences that are functional irrespective of their orientation and exhibit variable distances from their target genes. Given the critical role of tissue-specific enhancers in development and disease, annotating the human genome with tissue- or cell-type-specific enhancers has garnered significant attention. However, this task presents several challenges: • Vast Search Space: Enhancers are dispersed throughout the 98.5% of the human genome that is non-protein-coding, creating a vast search space. • Variable Positioning: Enhancers can regulate target genes from upstream, downstream, or intronic locations, and may skip proximal genes to influence more distant ones. • Complex Gene Regulation: Some enhancers simultaneously regulate multiple genes, adding to the complexity of their annotation. • Lack of a Universal Sequence Code: Unlike protein-coding genes, enhancers lack a defined sequence code, making prediction highly nontrivial. Traditional enhancer prediction approaches, such as those based on evolutionary conservation or biochemical markers, face inherent limitations. Evolutionary methods often miss lineage-specific enhancers, while biochemical marks are not always definitive indicators of enhancer activity and can appear stochastically. To address these challenges, we recently developed and published (FEBS Letters, https://doi.org/10.1002/1873-3468.15030) a DNA-sequence-based enhancer prediction pipeline tailored to tissue-specific transcription factor (TF) occupancy patterns. This sequence-based model improves enhancer prediction accuracy by incorporating the following: 1. A curated set of tissue- or cell-type-relevant transcription factors. 2. Well-characterized binding motifs for the selected TFs. 3. A benchmark dataset of enhancers validated in vivo or in vitro for the relevant tissue or cell type. Using the mammalian forebrain as a model, we applied this approach to predict 25,000 distinct forebrain enhancers within the non-coding and non-repetitive regions of the human genome (hg19). Functional Evaluation of Predicted Forebrain Enhancers: Our predicted enhancer datasets were evaluated by intersecting predictions with the following: • Active brain enhancer-associated chromatin marks. • DNase hypersensitivity (HS) site data from brain cell lines. • GWAS-based brain-specific SNP data. Additionally, subsets of the predictions were experimentally validated through in vivo zebrafish transgenic models. Evolutionary analysis revealed that >85% of these enhancers are conserved only in mammals or primates, underscoring their lineage-specific functionality. Utility of This Track Hub: This track hub presents the genomic coordinates of these 25,000 predicted forebrain enhancers (CRMs) in the hg19 genome assembly. Researchers can visualize and analyze these enhancers in the UCSC Genome Browser alongside abundant genomic and epigenomic datasets. This hub enables the following: 1. Investigating Pathological and Developmental Mechanisms: Explore the genomic basis of brain-related diseases and developmental processes. 2. Examining Evolutionary Significance: Study the gene-regulatory foundations of mammalian and primate brain evolution. Access the track hub and begin exploring these predicted forebrain enhancers in the context of gene bodies and genomic regions of interest. While utilizing these data for your publications, please remember to cite our relevant paper: Shireen, H., Batool, F., Khatoon, H., Parveen, N., Sehar, N.U., Noor, U.S., Hussain, I., Ali, S., Abbasi, A. A. (2024). Predicting genome-wide tissue-specific enhancers via combinatorial transcription factor genomic occupancy analysis. FEBS Letters. https://doi.org/10.1002/1873-3468.15030
Author: abbasiam
Session Name: Predicted human forebrain enahncers_hg19
Genome Assembly: hg38
Creation Date: 2024-12-17
Views: 33
1734422400 33
Description: ATAC-Seq from 8 sorted immune cell populations representing the early lymphoid hematopoietic differentiation cascade along the B cell lineage. Cell populations were isolated from healthy adult human bone marrow precursors and peripheral blood (n=13). A total of 78 samples are analyzed. Additional single-cell ATAC-Seq data from 5 healthy adult human bone marrow, recovering HSC, MPP, LMPP, CLP, cycling pro-B, pro-B, cycling pre-B, and pre-B cells, is analyzed.
Author: TransBioLab
Session Name: hg38_Brex
Genome Assembly: hg38
Creation Date: 2024-11-13
Views: 357
1731484800 357
Description: MultiRegion chrX 1 156040895 chrY 1 57227415 https://www.jax.org/jax-mice-and-services/ipsc The KOLF2.1J cell line was derived from the HPSI0114i-kolf_2 line through extensive molecular and cellular characterization efforts, including the correction of a pathogenic mutation in ARID2. https://www.hipsci.org/#/lines/HPSI0114i-kolf_2 Biosample: SAMEA2547615 https://www.ebi.ac.uk/biosamples/samples/SAMEA2547615 subject id SAMEA2398402 https://www.ebi.ac.uk/biosamples/samples/SAMEA2398402 Originating cell line seems to have no chrY data. CRAM file /17998_8%235.cram track name=17998_8%235.cram bigDataUrl=http://ftp.sra.ebi.ac.uk/vol1/run/ERR120/ERR1203439/17998_8%235.cram type=bam Session: https://genome.ucsc.edu/s/brianlee/cram_KOLF2
Author: brianlee
Session Name: cram_KOLF2
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 116
1731398400 116
Description: Module 08 Assignment
Author: LouisLiu
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 50
1731398400 50
Description: RHO/H1FOO
Author: sofiaterenziani
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38
1730966400 38
Description: NRL/CPNE6
Author: sofiaterenziani
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 43
1730966400 43
Description: GUCA1B/GUCA1A
Author: sofiaterenziani
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34
1730966400 34
Description: PDE6C/RBP4
Author: sofiaterenziani
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 39
1730966400 39
Description: mm9_NRL_CPNE6
Author: l.g.altizer
Session Name: mm9_NRL_CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 40
1730966400 40
Description: mm9_CPNE6_NRL
Author: l.g.altizer
Session Name: mm9_CPNE6_NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37
1730966400 37
Description: 11/7
Author: aehodges
Session Name: mm9//Nrl gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 33
1730966400 33
Description: mm9_RHO_H1FOO
Author: l.g.altizer
Session Name: mm9_RHO_H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 36
1730966400 36
Description: 11/7
Author: aehodges
Session Name: mm9//Guac1B gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 26
1730966400 26
Description: GUCA1B/GUCA1A
Author: madelinebarlas
Session Name: mm9 GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 40
1730966400 40
Description: multiomics
Author: diazacex
Session Name: Multiomics_mm9_wt_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: NRL/CPNE6
Author: madelinebarlas
Session Name: mm9 NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38
1730966400 38
Description: PDE6C/RBP4
Author: madelinebarlas
Session Name: mm9 PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 39
1730966400 39
Description: Mouse Retina stuff
Author: ALLDEREP
Session Name: mm9MouseRetina
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 42
1730966400 42
Description: PDE6C/RBP4
Author: madisonflorenz
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: NRL/CPNE6
Author: rchelsea
Session Name: mm9 NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37
1730966400 37
Description: RHO/H1FOO
Author: rchelsea
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38
1730966400 38
Description: GUCA1B/GUCA1A
Author: madisonflorenz
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: GUCA1B/GUCA1A
Author: rchelsea
Session Name: mm9 GUCA1B
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38
1730966400 38
Description: 11/7
Author: aehodges
Session Name: mm9//PDE6C gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 23
1730966400 23
Description: 11/7
Author: aehodges
Session Name: mm9//RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 36
1730966400 36
Description: PDE6C/RBP4
Author: rchelsea
Session Name: mm9 PDE6C
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 40
1730966400 40
Description: NRL/CPNE6
Author: madisonflorenz
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 36
1730966400 36
Description: mm9 wt CBR Nrl-
Author: diazacex
Session Name: mm9_BAM_wt CBR_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: RHO/H1FOO
Author: madisonflorenz
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 44
1730966400 44
Description: mm9_GUCA1B_GUCA1A
Author: l.g.altizer
Session Name: mm9_GUCA1B_GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 31
1730966400 31
Description: GB Multiomics custom data tracks - 3
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 3
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 39
1730966400 39
Description: mm9_CBR_RNA_seq
Author: l.g.altizer
Session Name: mm9_CBR_RNA_seq
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 34
1730966400 34
Description: wt CBRs Nrl- CBRs
Author: diazacex
Session Name: mm9_wt CBR_Nrl- CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 39
1730966400 39
Description: CBR regions with extra data
Author: ClaytonFannin
Session Name: mm9 CBR regions with extra data
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: RHO/H1FOO
Author: madelinebarlas
Session Name: mm9 RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 38
1730966400 38
Description: GB Multiomics custom data tracks - 2
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 2
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 47
1730966400 47
Description: mm9_NRL/WT
Author: l.g.altizer
Session Name: mm9_NRL/WT
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: mm9 CRX CBR mRNA
Author: madelinebarlas
Session Name: mm9 CRX CBR mRNA
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 35
1730966400 35
Description: 11/7/24
Author: aehodges
Session Name: mm9//2nd
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 39
1730966400 39
Description: mm9 CBR regions
Author: ClaytonFannin
Session Name: mm9 CBR regions
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37
1730966400 37
Description: GB Multiomics custom data tracks - 1
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 1
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 33
1730966400 33
Description: 11/7/24
Author: aehodges
Session Name: mm9//1st
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 26
1730966400 26
Description: mm9 CRX CBR
Author: madelinebarlas
Session Name: mm9 CRX CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 37
1730966400 37
Description: UCSC Genome browser features two custom tracks on chromosome 22, the regions from 20,100,000 to 20,140,000. The first track, titled as “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” traced with red ticks every 100 bases (by skip 100 bases), with a 100-base interval between each tick. The “even” track shows labels such as : “first,” “second,” and “third.” These tracks illustrates how BED format can be used to visualize specific genomic intervals with determined position.
Author: ankathi.s
Session Name: Module8 assignment
Genome Assembly: hg38
Creation Date: 2024-11-07
Views: 59
1730966400 59
Description: This UCSC Genome Browser session features two custom tracks on chromosome 22, covering the region from 20,100,000 to 20,140,000. The first track, titled “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” uses red ticks every 100 bases, with a 100-base interval between each tick. The “even” track also includes labels for the first three ticks: “first,” “second,” and “third.” These tracks demonstrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.arushi
Session Name: Module_8_assignment_hg38
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 53
1730880000 53
Description: This session features two custom tracks on chromosome 22 on hg38 assembly, covering the region from 20,100,000 to 20,140,000. The first track, labeled "spacer" marks blue ticks every 10,000 bases. The second track, called "even" displays red ticks at intervals of 100 bases, with a 100-base gap between each tick. Additionally, the "even" track includes labels for the first three ticks: "first," "second," and "third." These custom tracks illustrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.raj
Session Name: BINF 6310: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 46
1730880000 46
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Pratham donda
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 47
1730880000 47
Description: This is ganesan murugan's session
Author: ganesan.m
Session Name: ganesan_murugan
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 41
1730880000 41
Description: PDE6B: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 41
1730793600 41
Description: RNA-seq custom tracks activity - PDE6B
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 37
1730793600 37
Description: RNA-seq custom tracks activity - PDE6A
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 37
1730793600 37
Description: PDE6A: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 43
1730793600 43
Description: GNAT2: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: GNAT2_rec_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 41
1730793600 41
Description: GNAT 1: macula RNA-seq periperal retina RNA-seq
Author: diazacex
Session Name: GNAT1_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 44
1730793600 44
Description: RNA-seq custom tracks activity - GNAT2
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT2
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 42
1730793600 42
Description: RNA-seq custom tracks activity - GNAT1
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT1
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 51
1730793600 51
Description: RHO macula RNA-seq RHO periperal retina RNA-seq
Author: diazacex
Session Name: RHO_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 42
1730793600 42
Description: 11/5
Author: aehodges
Session Name: hg38//custom tracks
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 25
1730793600 25
Description: RNA-seq custom tracks activity - RHO
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - RHO
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 54
1730793600 54
Description: Rhodopsin
Author: ALLDEREP
Session Name: hg38RHOMacula
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 48
1730793600 48
Description: This custom track displays genomic intervals from the provided test.bed file, showing regions of interest for our class assignment. The data spans chromosomes 1 and 7 and highlights segments related to gene regulation and expression.
Author: Shamitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 72
1730793600 72
Description: This session contains custom tracks visualizing specific features on chromosome 22 between positions 20,100,000 and 20,140,000. It includes: Spacer Track: Description: Blue ticks placed every 10,000 bases. Color: Blue (RGB: 0, 0, 255) Key Positions: chr22:20100000-20100001 chr22:20110000-20110001 chr22:20120000-20120001 Even Track: Description: Red ticks placed every 100 bases, with skips of 100 bases between ticks. Color: Red (RGB: 255, 0, 0) Key Positions: chr22:20100000-20100100 (first) chr22:20100200-20100300 (second) chr22:20100400-20100500 (third)
Author: taliaroth19
Session Name: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-04
Views: 47
1730707200 47
Description: customs tracks but better
Author: ALLDEREP
Session Name: hg38CustomTracksPractice - EA
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 49
1730361600 49
Description: custom tracks
Author: ALLDEREP
Session Name: CustomTracks_Test
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 55
1730361600 55
Description: CLIP2 is a gene that is related to linker protein function. Various RefSeq comparisons are aligned with expression levels from a variety of tissues.
Author: gwilds
Session Name: clip2
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 52
1730361600 52
Description: MAPT mutations
Author: diazacex
Session Name: MAPT GB custom tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 55
1730361600 55
Description: MAPT mutations looged by Clayton Fannin
Author: ClaytonFannin
Session Name: hg38 MAPT mutations Group 5 (CAF)
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 58
1730361600 58
Description: 10/31 Intro to UCSC Custom Data tracks
Author: madisonflorenz
Session Name: 10/31 Intro to UCSC Custom Data tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 48
1730361600 48
Description: 10/31/24
Author: aehodges
Session Name: hg38//MAPT gene
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 47
1730361600 47
Description: UCSC GB custom tracks intro part 1A
Author: madisonflorenz
Session Name: UCSC GB custom tracks intro part 1A
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 53
1730361600 53
Description: practicing custom tracks
Author: diazacex
Session Name: RHO Practice
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 47
1730361600 47
Description: 10/31/24
Author: aehodges
Session Name: hg19//custom track
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 36
1730361600 36
Description: ELK3 promoter region
Author: gauravagarwal
Session Name: ELK3_promoter
Genome Assembly: hg38
Creation Date: 2024-10-29
Views: 437
1730188800 437
Description: epigenomic data generated for the training study
Author: weitzela
Session Name: 2024-10_training-study
Genome Assembly: rn7
Creation Date: 2024-10-25
Views: 185
1729843200 185
Description: Looking at the mutations in distal and tumor tissue of liver (hepatocellular carcinoma) in Patient #8. The mutations found exclusively in tumor tissue biopsy are highlighted in blue windows.
Author: dlk_browse
Session Name: Patient8_ND6
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 909
1728892800 909
Description: Ridley Ch 4 HTT Fig 1
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 1
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 210
1728892800 210
Description: Ridley Ch 4 HTT Fig 2
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 2
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 196
1728892800 196
Description: 10/13/24
Author: aehodges
Session Name: hg38/HTT Gene
Genome Assembly: hg38
Creation Date: 2024-10-13
Views: 55
1728806400 55
Description: THP-1 monocyte PMA timecourse
Author: Firefoot97
Session Name: T2T_monocyte_PMA_timecourse
Genome Assembly: hub_3671779_hs1
Creation Date: 2024-10-10
Views: 68
1728547200 68
Description: Tracks H3K9me3 during E5 gametocytogenesis
Author: sandracula
Session Name: Sci-Rep_H3K9me3_gametocytes
Genome Assembly: hub_4042823_pfa2
Creation Date: 2024-10-04
Views: 203
1728028800 203
Description: For Art & Katja
Author: mc.sierant
Session Name: RNU4-2_cons
Genome Assembly: hg38
Creation Date: 2024-09-30
Views: 387
1727683200 387
Description: Genes e Microssatélites do Salminus brasiliensis set/2024 - LARGE_UFSJ
Author: jguimasr
Session Name: LARGE_UFSJ-GCA_030463535.1
Genome Assembly: hub_4414904_GCA_030463535.1
Creation Date: 2024-08-05
Views: 120
1722844800 120
Description: Exon 10
Author: sofiaterenziani
Session Name: Exon 10 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-26
Views: 67
1727337600 67
Description: HDG_hg38
Author: l.g.altizer
Session Name: HDG_hg38
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 276
1727164800 276
Description: HDG gene
Author: sofiaterenziani
Session Name: hg38 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 241
1727164800 241
Description: 9/24/24
Author: aehodges
Session Name: hg38//HGD session 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 230
1727164800 230
Description: HGD gene - Figure 2
Author: madisonflorenz
Session Name: HGD gene - Figure 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 73
1727164800 73
Description: Human genome HGD gene
Author: rchelsea
Session Name: hg38 HGD #1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 46
1727164800 46
Description: hg38HGDExon10
Author: ALLDEREP
Session Name: hg38HGDExon10
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 82
1727164800 82
Description: HGD gene - Figure 1
Author: madisonflorenz
Session Name: HGD gene - Figure 1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 85
1727164800 85
Description: hg38 HGD
Author: ALLDEREP
Session Name: hg38 HGD
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 73
1727164800 73
Description: edwcdewd
Author: maddiebendele
Session Name: HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-23
Views: 70
1727078400 70
Description: 9/20/24
Author: aehodges
Session Name: hg38//HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-20
Views: 57
1726819200 57
Description: Human chr2 compared to other mammals
Author: sofiaterenziani
Session Name: hg38 - chr2 + other organisms
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 318
1726560000 318
Description: Human and other primates
Author: rchelsea
Session Name: hg38 chr2 #2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 253
1726560000 253
Description: 9/17/24
Author: aehodges
Session Name: hg38//session 2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 267
1726560000 267
Description: Region of Human Chr2 in Ridley Chapter and Other Primates
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter and Other Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 71
1726560000 71
Description: wow
Author: maddiebendele
Session Name: Fusion_Event_Bendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 72
1726560000 72
Description: Synteny and Conservation among Primates and the human
Author: ALLDEREP
Session Name: Synteny and Conservation among Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 68
1726560000 68
Description: Human and chimp chromosome #2
Author: rchelsea
Session Name: hg38 chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 75
1726560000 75
Description: hg38 chromosome 2 comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 93
1726560000 93
Description: region of human chromosome 2 discussed in the Ridley chapter
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 70
1726560000 70
Description: Humans vs different Ape comparison of chr 3
Author: diazacex
Session Name: Comparison of Chr 3
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 71
1726560000 71
Description: hg38 chromosome 2 full comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 full comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 79
1726560000 79
Description: Human chromosome 2 in comparison to chimp chromosomes to show fusion.
Author: l.g.altizer
Session Name: Chimp_fusion
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 75
1726560000 75
Description: Human fusion
Author: maddiebendele
Session Name: FusionEventBendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 64
1726560000 64
Description: L1_ALS_trackDb
Author: UCSC_Rambo
Session Name: L1_ALS_trackDb
Genome Assembly: hg38
Creation Date: 2024-11-26
Views: 62
1732608000 62
Description: for prez
Author: maddiebendele
Session Name: p.aergiona presentation
Genome Assembly: hub_3560215_GCF_000006765.1
Creation Date: 2024-09-17
Views: 95
1726560000 95
Description: Ridley Ch2 Species Pt. 1
Author: madisonflorenz
Session Name: Ridley Ch2 Species Pt. 1
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 72
1726560000 72
Description: Comparison on Chr2 with chimps
Author: sofiaterenziani
Session Name: hg38 - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 65
1726560000 65
Description: human chr2 synteny to chimps
Author: marte2je
Session Name: hg38 chimp - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 60
1726560000 60
Description: comparison of the KPNA6 gene from humans to opossums
Author: ALLDEREP
Session Name: M.Domestica Comparison
Genome Assembly: hg19
Creation Date: 2024-09-15
Views: 71
1726387200 71
Description: H3K27ac ChIP-seq and RNA-seq of lung neuroendocrine tumors from GSE247574.
Author: yotamd
Session Name: lung_NET
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 409
1725955200 409
Description: CRX gene isoforms
Author: madisonflorenz
Session Name: CRX gene isoforms
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 298
1725955200 298
Description: CRX gene
Author: ClaytonFannin
Session Name: CRX gene BIO481 CAF
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 326
1725955200 326
Description: 9/10
Author: aehodges
Session Name: CRX Gene
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 76
1725955200 76
Description: The custom tracts represent Hop1 ChIP-Seq data in wild type, ATPase deficient mutant and null mutant. Bam files contains uniquely mapped reads to S. cerevisiae genome. The sample information is given below: 1. m_sorted_mapped_cer_HP1_4h_Ch_1.bam- Hop1 WT replicate 1, 2. m_sorted_mapped_cer_HP1_4h_Ch_2.bam- Hop1 WT replicate 2, 3. m_sorted_mapped_cer_HP1_4h_In_1.bam- Hop1 WT input, 4. m_sorted_mapped_cer_SK_Hp1m_4h_Ch1.bam- Hop1 ATPase mutant replicate 1, 5. m_sorted_mapped_cer_SK_Hp1m_4h_Ch2.bam- Hop1 ATPase mutant replicate 2, 6. m_sorted_mapped_cer_SK_Hp1m_4h_In2.bam- Hop1 ATPase mutant input, 7. m_sorted_mapped_cer_hp1_4h_Ch_1.bam- Hop1 null mutant repliacte 1, 8. m_sorted_mapped_cer_hp1_4h_Ch_2.bam- Hop1 null mutant replicate 2, 9. m_sorted_mapped_cer_hp1_4h_In_1.bam- Hop1 null mutant input
Author: Sameerjoshi1997
Session Name: Hop1 ChIP-Seq data
Genome Assembly: sacCer3
Creation Date: 2024-09-04
Views: 407
1725436800 407
Description: Quiz 2
Author: sofiaterenziani
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 311
1725350400 311
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO redo
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 303
1725350400 303
Description: Quiz 1
Author: sofiaterenziani
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 84
1725350400 84
Description: RHO
Author: diazacex
Session Name: RHO_hg19
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 89
1725350400 89
Description: hg19 RHO
Author: madelinebarlas
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 91
1725350400 91
Description: RHO gene and OMIM Alleles
Author: l.g.altizer
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 84
1725350400 84
Description: RHO Gene & OMIM & Multi
Author: l.g.altizer
Session Name: hg19_RHO_2
Genome Assembly: hg38
Creation Date: 2024-09-03
Views: 87
1725350400 87
Description: RHO
Author: ALLDEREP
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 99
1725264000 99
Description: hg19 RHO - quiz #2
Author: madisonflorenz
Session Name: hg19 RHO - quiz #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 68
1725264000 68
Description: hg19 RHO - Quiz 1
Author: gplaughon912
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 76
1725264000 76
Description: hg19 RHO - Quiz 2
Author: gplaughon912
Session Name: hg19 RHO - Session 2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 89
1725264000 89
Description: RHO NEW
Author: ALLDEREP
Session Name: hg19RHO NEW
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 76
1725264000 76
Description: same as the previous rho but with highlight
Author: maddiebendele
Session Name: hg19 RHO2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 72
1725264000 72
Description: Quiz 2
Author: aehodges
Session Name: hg19 RHO session 2
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 73
1725177600 73
Description: hg19 RHO
Author: ClaytonFannin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 75
1725177600 75
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-08-31
Views: 86
1725091200 86
Description: Fall24 MouseBIO481 group5 (CAF)
Author: ClaytonFannin
Session Name: Fall24 MouseBIO481 group5 (CAF)
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 85
1724918400 85
Description: Fall24 Worm BIO481 group#3
Author: madisonflorenz
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 57
1724918400 57
Description: First experience using UCSC Genome Browser looking at the Rhodopsin gene of a mouse
Author: ALLDEREP
Session Name: Fall24 MouseBIO481 group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 95
1724918400 95
Description: C.elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3 #2
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 47
1724918400 47
Description: Fall24 MouseBIO481 group6
Author: madelinebarlas
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 95
1724918400 95
Description: CGEMS Mouse AEH Test
Author: aehodges
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 104
1724918400 104
Description: Fall24 Worm BIO481 group#3 C. elegans
Author: sofiaterenziani
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 76
1724918400 76
Description: Fall24 Worm BIO481 group 3
Author: rchelsea
Session Name: Fall24 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 94
1724918400 94
Description: MEK
Author: diazacex
Session Name: Fall24 Yeast BIO481 group#2
Genome Assembly: sacCer3
Creation Date: 2024-08-29
Views: 70
1724918400 70
Description: In class assignment 8/29
Author: Mitcheij
Session Name: Fall24 Worm BIO481 group 4
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 91
1724918400 91
Description: C. elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 74
1724918400 74
Description: BIO481 UCSC Genome Browser Assignment - Group 5 Mouse
Author: gplaughon912
Session Name: Fall24 MouseBIO481 Group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 108
1724918400 108
Description: Manuscript: Feedback Regulation of Retinaldehyde Reductase DHRS3, A Critical Determinant of Retinoic Acid Homeostasis Online resources: Potential RAR-bound regions, were identified using the ChIP-Seq tracks from the ReMap2022 Atlas on the GRCm38/mm10 mouse genome [1], accessed via the UCSC Genome Browser in April 2024 and filtered for RAR-ChIP sets. Potential RARE motifs were identified using TRANSFAC and JASPAR databases [2]. RAR ChIP-Seq tracks from ReMap and promoter and enhancer elements contained in ENCODE [3] are depicted in Fig. S4. 1. Hammal, F., de Langen, P., Bergon, A., Lopez, F. & Ballester, B. (2022) ReMap 2022: a database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments, Nucleic Acids Res. 50, D316-D325. 2. Rauluseviciute, I., Riudavets-Puig, R., Blanc-Mathieu, R., Castro-Mondragon, J. A., Ferenc, K., Kumar, V., Lemma, R. B., Lucas, J., Cheneby, J., Baranasic, D., Khan, A., Fornes, O., Gundersen, S., Johansen, M., Hovig, E., Lenhard, B., Sandelin, A., Wasserman, W. W., Parcy, F. & Mathelier, A. (2024) JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles, Nucleic Acids Res. 52, D174-D182. 3. Consortium, E. P., Moore, J. E., Purcaro, M. J., Pratt, H. E., Epstein, C. B., Shoresh, N., Adrian, J., Kawli, T., Davis, C. A., Dobin, A., Kaul, R., Halow, J., Van Nostrand, E. L., Freese, P., Gorkin, D. U., Shen, Y., He, Y., Mackiewicz, M., Pauli-Behn, F., Williams, B. A., Mortazavi, A., Keller, C. A., Zhang, X. O., Elhajjajy, S. I., Huey, J., Dickel, D. E., Snetkova, V., Wei, X., Wang, X., Rivera-Mulia, J. C., Rozowsky, J., Zhang, J., Chhetri, S. B., Zhang, J., Victorsen, A., White, K. P., Visel, A., Yeo, G. W., Burge, C. B., Lecuyer, E., Gilbert, D. M., Dekker, J., Rinn, J., Mendenhall, E. M., Ecker, J. R., Kellis, M., Klein, R. J., Noble, W. S., Kundaje, A., Guigo, R., Farnham, P. J., Cherry, J. M., Myers, R. M., Ren, B., Graveley, B. R., Gerstein, M. B., Pennacchio, L. A., Snyder, M. P., Bernstein, B. E., Wold, B., Hardison, R. C., Gingeras, T. R., Stamatoyannopoulos, J. A. & Weng, Z. (2020) Expanded encyclopaedias of DNA elements in the human and mouse genomes, Nature. 583, 699-710.
Author: alexmoise1
Session Name: mm10 RAR cREs Mouse Dhrs3
Genome Assembly: mm10
Creation Date: 2024-08-16
Views: 899
1723795200 899
Description: CRX
Author: ALLDEREP
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-12
Views: 87
1726128000 87
Description: For Bioinformatics class assignment purpose, to be viewed by the instructors.
Author: hemib
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2024-10-08
Views: 63
1728374400 63
Description: CUT&RUN dataset for Six3 (with antibodies Six3_abs and Six3_ori), Six6, and IgG control for mouse embryonic retinas at E13.5.
Author: Wei_einstein
Session Name: PlosOne
Genome Assembly: mm10
Creation Date: 2024-08-08
Views: 681
1723104000 681
Description: hg19 RHO altered for quiz 2
Author: ClaytonFannin
Session Name: hg19 RHO altered
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 72
1725264000 72
Description: GWAS endometriosis associations around RERG
Author: Pkgg77
Session Name: RERG - ras ER reg high in uterus CHR12
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 1475
1721635200 1475
Description: This session shows how UShER can place H5N1 sequences on the tree of viral samples. Here are the steps to replicate a similar session. First find an example viral sequence such as SRR28752449_HA_cns.fa in this repository: https://github.com/andersen-lab/avian-influenza/tree/master/fasta With the fasta sequence copied follow these steps. 1. Navigate to UShER, quick link: https://usher.bio 2. Paste in a sequence: >Consensus_SRR28752449_HA_cns_threshold_0.5_quality_20 ATGGAGAACATAG... 3. Click "Upload" 4. Click "View in Genome Browser" 5. Note the placement near the branch of H5N1 near other cattle lineages (click session image on the left to see, find the light blue horizontal line highlighting Consensus_SRR28752449).
Author: brianlee
Session Name: H5N1
Genome Assembly: hub_4086371_GCF_000864105.1
Creation Date: 2024-07-01
Views: 1476
1719820800 1476
Description: hg38 CNGB1 alt polyA isoforms
Author: renkejhsph
Session Name: hg38 CNGB1 alt polyA isoforms
Genome Assembly: hg38
Creation Date: 2024-06-19
Views: 1015
1718784000 1015
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_1
Genome Assembly: hg19
Creation Date: 2024-10-29
Views: 56
1730188800 56
Description: HumanDevelopingRetinaAtlas
Author: zhenzuo2
Session Name: HumanDevelopingRetinaAtlas
Genome Assembly: hg38
Creation Date: 2024-06-06
Views: 763
1717660800 763
Description: "A two-step regulatory mechanism dynamically controls histone H3 acetylation by SAGA complex at growth-related promoters" paper genome wide data (Zencir et al., 2024)
Author: sevil
Session Name: GSE268170_BIGWIG FILES
Genome Assembly: sacCer3
Creation Date: 2024-06-05
Views: 483
1717574400 483
Description: All QTLs from datasets in our S. cerevisiae QTL datasets reanalysis. QTL Track Name Format: - GENE::dataset_name$$LOD, where LOD is rounded to the nearest integer Relevant Fields: - Color: blue for mRNA QTLs, brown for protein QTLs, black for xQTLs - Color Intensity: darker with increasing QTL LOD - Strand: direction of QTL as considered in the paper - Arrows: right for positive QTL effect
Author: matthewf
Session Name: Reanalysis of QTL Datasets
Genome Assembly: sacCer3
Creation Date: 2024-08-05
Views: 106
1722844800 106
Description: long retinal isoform of shisa5
Author: JonathanM70
Session Name: hg38 shisa5 long isoform
Genome Assembly: hg38
Creation Date: 2024-06-03
Views: 373
1717401600 373
Description: Chip-seq
Author: ucscfzl
Session Name: SIRT3KO
Genome Assembly: hg38
Creation Date: 2024-08-21
Views: 100
1724227200 100
Description: nair
Author: xiaopei
Session Name: hg38_xiaopei_May20
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 562
1716192000 562
Description: test
Author: xiaopei
Session Name: hg38_test2
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 467
1716192000 467
Description: test 1
Author: xiaopei
Session Name: hg38_test1
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 359
1716192000 359
Description: ATAC-seq YZ
Author: Yichao Zhou
Session Name: NewATAC-seq analysis
Genome Assembly: mm10
Creation Date: 2024-05-20
Views: 70
1716192000 70
Description: hg18_rnaseq
Author: hyfydky
Session Name: hg18_rnaseq
Genome Assembly: hg18
Creation Date: 2024-05-18
Views: 177
1716019200 177
Description: hg38_GSE176016
Author: hyfydky
Session Name: hg38_GSE176016
Genome Assembly: hg38
Creation Date: 2024-05-10
Views: 748
1715328000 748
Description: c.4619T>G P.Leu1540Arg Revel score
Author: sk202
Session Name: VWF_1540
Genome Assembly: hg19
Creation Date: 2024-05-16
Views: 173
1715846400 173
Description: test
Author: yunna
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-05-02
Views: 353
1714636800 353
Description: isPCR hits in two adjacent genes. Shows amplicons expected if using mRNA as template.
Author: netherlands2024
Session Name: hg19_isPCR
Genome Assembly: hg19
Creation Date: 2024-04-29
Views: 1246
1714377600 1246
Description: CRX binding sites for HTT gene in mouse genome
Author: eraterman
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1573
1712736000 1573
Description: CRX binding sites for THRB gene in mouse genome
Author: eraterman
Session Name: mm9 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1170
1712736000 1170
Description: CRX binding sites for PDE6A gene in mouse genome
Author: eraterman
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 472
1712736000 472
Description: CRX binding sites for RCVRN gene in mouse genome
Author: eraterman
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 209
1712736000 209
Description: CRX binding sites for RHO gene in mouse genome
Author: eraterman
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 206
1712736000 206
Description: class assignment 4-10-24
Author: ShMaBe
Session Name: CRX ChIP Seq wt Nrl
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 188
1712736000 188
Description: lab 4-3
Author: Ruffi2ec
Session Name: Lab due 4-3
Genome Assembly: hg38
Creation Date: 2024-04-04
Views: 188
1712217600 188
Description: This session contains a custom track showing near coding regions in PanelApp green genes, as described in the article "Systematic identification of disease-causing promoter and untranslated region variants in 8,040 undiagnosed individuals with rare disease" Martin-Geary et al 2024
Author: ageary
Session Name: CRDG 'Near coding regions' Martin-Geary et al '24
Genome Assembly: hg38
Creation Date: 2024-04-05
Views: 229
1712304000 229
Description: yes
Author: aryanzandi123
Session Name: REST and Co-repressor Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 24
1733904000 24
Description: a demo
Author: xiyuan09
Session Name: xyuan2024-hg19
Genome Assembly: hg19
Creation Date: 2024-03-30
Views: 403
1711785600 403
Description: U2AF2 iCLIP (Sutandy et al 2018) and eCLIP (ENCODE) processed with racoon_clip
Author: melinak
Session Name: U2AF2_iCLIP_and_eCLIP
Genome Assembly: hg38
Creation Date: 2024-04-12
Views: 199
1712908800 199
Description: Ribosome Footprinting profile of miR181a/b-1 knockout vs wildtype in mouse thymocytes with three samples each. Data from Verheyden and Klostermann et al. 2024 (https://www.biorxiv.org/content/10.1101/2023.09.08.556730v1)
Author: melinak
Session Name: miR181_RibosomeFootprint_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-26
Views: 589
1711440000 589
Description: hg19 RHO #2 Quiz #@
Author: rchelsea
Session Name: hg19 RHO #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 51
1725264000 51
Description: hg19 RHO Quiz #1
Author: rchelsea
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 95
1725264000 95
Description: hg19 RHO
Author: madisonflorenz
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 85
1725264000 85
Description: miR181-eCLIP data from Verheyden and Klostermann et.al. 2024. Shown are the chimeric and non-chimeric crosslinks for four conditions: Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout Ago2 IP with miR181a/b-1 knockout and a following enrichment for miR181 In addition binding sites are shown for Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout And the differential binding sites of Ago2 IP with miR181a/b-1 knockout vs Ago2 IP
Author: melinak
Session Name: miR181-eCLIP_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-25
Views: 335
1711353600 335
Description: This browser track accompanies the Alternative Proteome Detection Project out of the Sheynkman Lab at the University of Virginia.
Author: emilyfwatts
Session Name: Alternative-Proteome-Detection
Genome Assembly: hg38
Creation Date: 2024-03-15
Views: 379
1710489600 379
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2024_fig6
Genome Assembly: hg19
Creation Date: 2024-03-11
Views: 733
1710144000 733
Description: Test session for Module 7 of BINF 6310.
Author: oconnor.ea
Session Name: oconnor-binf6310
Genome Assembly: hg38
Creation Date: 2024-03-01
Views: 874
1709280000 874
Description: Blue ticks every 10000 bases. Red ticks every 100 bases, skip 100
Author: lizkiefer
Session Name: hg38_chr22_KieferLiz
Genome Assembly: hg38
Creation Date: 2024-02-27
Views: 1342
1709020800 1342
Description: ATAC-seq of MaSC(mammary stem cell)
Author: woaichixiangcai
Session Name: MaSC_ATAC
Genome Assembly: mm10
Creation Date: 2024-02-18
Views: 669
1708243200 669
Description: Track Decorators help page: https://genome.ucsc.edu/goldenPath/help/decorator.html
Author: BGMP2024
Session Name: Track_Decorators
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 634
1706428800 634
Description: Highlighted exons 5-8 of ENST00000269305.9
Author: BGMP2024
Session Name: hg38_BGMP2024_Ex
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 752
1706428800 752
Description: practice
Author: jordancibellis
Session Name: hg19_480L
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 583
1706083200 583
Description: BIO480L Spring 24
Author: penguinttoes
Session Name: hg19_newsome
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 333
1706083200 333
Description: This is Harshini and Jenn's steps to solve FAD!
Author: creminslab
Session Name: FAD_Harshini_hg38
Genome Assembly: hg38
Creation Date: 2024-01-19
Views: 324
1705651200 324
Description: te
Author: aryanzandi123
Session Name: Polycomb and Chromatin-Binding Proteins Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 22
1733904000 22
Description: This session features a track hub with MaveDB experiment datasets mapped to the GRCh38 reference genome
Author: mcline
Session Name: MaveDB
Genome Assembly: hg38
Creation Date: 2024-04-03
Views: 272
1712131200 272
Description: PE2 editing efficiency in synHEK3 reporters in K562 cells
Author: lxyttpp912
Session Name: hg38_synHEK3_hub
Genome Assembly: hg38
Creation Date: 2023-12-26
Views: 765
1703577600 765
Description: Differentially methylated CGIs under DiPRO/ZNF555 knockdown in human rhabdomyosarcoma and myoblast cells (shDiPRO1 vs. non-targeting shCTL)
Author: dr_finder
Session Name: metCGI_ZNF55/DiPRO1_2023
Genome Assembly: hg38
Creation Date: 2023-12-20
Views: 196
1703059200 196
Description: Coverage tracks from SF3B1-humanized yeast treated with splicing inhibitors Plad-B and Thail-A from Hunter et al. Published in RNA
Author: mannyares
Session Name: Hunter_etal
Genome Assembly: sacCer3
Creation Date: 2023-12-13
Views: 733
1702454400 733
Description: may
Author: xiaopei
Session Name: hg38_xiaopei_May21
Genome Assembly: hg38
Creation Date: 2024-05-21
Views: 163
1716278400 163
Description: bigWig files for promoter NDR resetting after replication (Zencir et al.,2024)
Author: julien_soudet
Session Name: EdU_replication
Genome Assembly: sacCer3
Creation Date: 2024-05-31
Views: 158
1717142400 158
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. View of AS imprinted region as shown in Figure 7A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: AS_Locus_Fig7A_Fugon_2024
Genome Assembly: hg19
Creation Date: 2023-12-06
Views: 148
1701849600 148
Description: A snapshot from the genome browser displaying the enrichment of H3K27ac in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 571
1701590400 571
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 373
1701590400 373
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 347
1701590400 347
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 283
1701590400 283
Description: The UCSC Browser show the enrichment of the H3K18la signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 298
1701590400 298
Description: The UCSC Browser show the enrichment of the H3K18la signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 290
1701590400 290
Description: A snapshot from the genome browser displaying the enrichment of H3K18la in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 289
1701590400 289
Description: The UCSC Browser show the enrichment of the H3K18la signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 292
1701590400 292
Description: ZC3 ChIP
Author: yannfrey
Session Name: ZC3 ChIP
Genome Assembly: hg38
Creation Date: 2023-11-26
Views: 441
1700985600 441
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. Zoomed in view of the MAGEL2 anchor region as shown in Figure 9A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: MAGEL2_Fig9A _Fugon_2024
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 108
1721635200 108
Description: RNA omics stuff
Author: nrpowell
Session Name: 2023_Nov_CYP3A4_fold/m6a/eclip_comparison
Genome Assembly: hg38
Creation Date: 2023-11-20
Views: 592
1700467200 592
Description: Tdg&p53
Author: [email protected]
Session Name: Tdg&p53
Genome Assembly: mm10
Creation Date: 2023-11-18
Views: 322
1700294400 322
Description: PDE6C&RBP4
Author: gracewattawa
Session Name: PDE6C&RBP4
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 367
1699948800 367
Description: p
Author: julianna0220
Session Name: PDE6C
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 374
1699948800 374
Description: GUCA1B&GUCA1A
Author: gracewattawa
Session Name: GUCA1B&GUCA1A
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 234
1699948800 234
Description: d
Author: julianna0220
Session Name: GUCA1B
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 319
1699948800 319
Description: mm9 PDE6C/RBP4 Multiomics
Author: chelseadonovan
Session Name: mm9 PDE6C/RBP4 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 337
1699948800 337
Description: NRL&CPNE6
Author: gracewattawa
Session Name: NRL&CPNE6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 220
1699948800 220
Description: d
Author: julianna0220
Session Name: cone6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 320
1699948800 320
Description: nrl version of everything
Author: joshraynes
Session Name: Nrl version
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 309
1699948800 309
Description: RHO&H1foo
Author: gracewattawa
Session Name: RHO&H1foo rnaseq
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 203
1699948800 203
Description: pho
Author: julianna0220
Session Name: RHO Pho
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 325
1699948800 325
Description: mm9 GUCA1B/GUCA1A Multiomics
Author: chelseadonovan
Session Name: mm9 GUCA1B/GUCA1A Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 295
1699948800 295
Description: mm9 NRL/CPNE6 Multiomics
Author: chelseadonovan
Session Name: mm9 NRL/CPNE6 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 342
1699948800 342
Description: RNASEQnrl
Author: gracewattawa
Session Name: RNASEQnrl
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 312
1699948800 312
Description: mm9 RHO Multiomics
Author: chelseadonovan
Session Name: mm9 RHO Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 327
1699948800 327
Description: BINF6310
Author: varun1010
Session Name: hg38_assignment7_1
Genome Assembly: hg38
Creation Date: 2023-11-12
Views: 330
1699776000 330
Description: RCVRN gene
Author: Isabella Lindblad
Session Name: 11-9_mouse3_RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 324
1699516800 324
Description: mm9 RCVRN CBR sites
Author: chelseadonovan
Session Name: mm9 RCVRN CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 325
1699516800 325
Description: RCVRN
Author: kenzie.prettyman
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 321
1699516800 321
Description: rcvrn
Author: julianna0220
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: HTT
Author: kenzie.prettyman
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 357
1699516800 357
Description: mm9 HTT CBR sites
Author: chelseadonovan
Session Name: mm9 HTT CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 328
1699516800 328
Description: HTT
Author: julianna0220
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 321
1699516800 321
Description: CRX binding regions of PDE6A
Author: taylo2ga
Session Name: Mouse PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: THRB
Author: kenzie.prettyman
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 321
1699516800 321
Description: thrb
Author: julianna0220
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 312
1699516800 312
Description: mm9 THRB CBR sites
Author: chelseadonovan
Session Name: mm9 THRB CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 330
1699516800 330
Description: PDE6A
Author: kenzie.prettyman
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: RHO nrl- onlh
Author: joshraynes
Session Name: RHO Nrl-
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 302
1699516800 302
Description: PDE6A
Author: julianna0220
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: mm9 PDE6A CBR sites
Author: chelseadonovan
Session Name: mm9 PDE6A CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: Viewing Mouse Genome 2007 (mm9), RHO gene with CRX binding sites
Author: chelseadonovan
Session Name: mm9 RHO CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 328
1699516800 328
Description: crx binding
Author: julianna0220
Session Name: CRX JP
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 324
1699516800 324
Description: CBR data in PDE6A gene on mouse mm9 genome
Author: ryleestrother
Session Name: CBR PDE6A mm9
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 322
1699516800 322
Description: CBR regions of the RCVRN gene
Author: taylo2ga
Session Name: Mouse RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 316
1699516800 316
Description: crx binding sites
Author: gracewattawa
Session Name: CRX binding sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 323
1699516800 323
Description: CRX binding regions of the gene HTT
Author: taylo2ga
Session Name: Mouse HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 315
1699516800 315
Description: CRX binding sites wt and mutant
Author: kenzie.prettyman
Session Name: CRX
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 342
1699516800 342
Description: Enke Bio481 THRB Gene in mm9
Author: cooperki
Session Name: THRB_Mouse
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 304
1699516800 304
Description: RHO gene
Author: Isabella Lindblad
Session Name: 11-9_mouse_RHO
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 310
1699516800 310
Description: CRX binding regions of the THRB gene
Author: taylo2ga
Session Name: Mouse THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 311
1699516800 311
Description: binf6310 hg38 custom track
Author: sydneycole
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-05
Views: 441
1699171200 441
Description: test.bed custom tracks
Author: rpatel01
Session Name: binfmodule7
Genome Assembly: hg38
Creation Date: 2023-11-03
Views: 705
1698998400 705
Description: BINF6310 MODULE 7
Author: Pruthweish27
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 602
1698739200 602
Description: BINF6310 MODULE 7
Author: sreepoojitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 331
1698912000 331
Description: ancestry - taster nontaster
Author: fareehaa_ahm
Session Name: ancestry
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 321
1698912000 321
Description: hg19 TAS2R38 Ancestry Data
Author: chelseadonovan
Session Name: hg19 TAS2R38 Ancestry Data
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 332
1698912000 332
Description: ancestry
Author: julianna0220
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 306
1698912000 306
Description: Ancestry.com SNPs
Author: ryleestrother
Session Name: hg19 ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 304
1698912000 304
Description: Ancestry.com data
Author: kenzie.prettyman
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 313
1698912000 313
Description: custom tracks - BIO 481
Author: fareehaa_ahm
Session Name: MYBPC1_customtracks_Fareeha
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 341
1698912000 341
Description: MYBPC1
Author: julianna0220
Session Name: MYBPC1 JP
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 315
1698912000 315
Description: Final with descriptions
Author: rahrigHK
Session Name: MYBPC1 Activity (Final)
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 319
1698912000 319
Description: MYBPC1 session
Author: joshraynes
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 306
1698912000 306
Description: MYBPC1 assignment
Author: kenzie.prettyman
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 319
1698912000 319
Description: hg19 assembly showing MYBPC1 gene & custom tracks
Author: chelseadonovan
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 323
1698912000 323
Description: BINF_6310 Module 7
Author: kandalkarankita
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 311
1698912000 311
Description: BINF-6310
Author: Harshini144
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 312
1698912000 312
Description: BINF 6310 Module 7
Author: nallaboluvikas
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-01
Views: 941
1698825600 941
Description: Custom tracks for genomic variants on chr22
Author: sdzzwzy
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-11-01
Views: 320
1698825600 320
Description: BINF6310
Author: SaradaPriya_Mns
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 540
1698739200 540
Description: binf6310
Author: varun1010
Session Name: hg38_assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 419
1698739200 419
Description: BINF 6310
Author: Pavitra Dass
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 333
1698739200 333
Description: BINF6310
Author: Meghana09
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 415
1698739200 415
Description: custom link for assignment7
Author: srivastava.sank
Session Name: assignment7track
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 311
1698739200 311
Description: DAG session
Author: DaniGonzalez
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 52
1730361600 52
Description: Incorporating a customized track
Author: Tanvi
Session Name: test
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 332
1698739200 332
Description: BINF6310 Assignment: Incorporating a customized track using the provided bed file into the UCSC Genome Browser. Submitted by AashkaB
Author: aashka.b
Session Name: test_session_AB
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 324
1698739200 324
Description: This is a session run as a part of assignment for the course BINF6310
Author: Unnati Jonnavithula
Session Name: UJ1
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 327
1698739200 327
Description: this is the assignment
Author: yuqiaotang
Session Name: 6300assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 341
1698739200 341
Description: Module 7 - BIF6310
Author: trangtu97
Session Name: hg38_human
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 318
1698652800 318
Description: test for school
Author: tojaga.m
Session Name: Eosinophil
Genome Assembly: hg38
Creation Date: 2023-10-26
Views: 336
1698307200 336
Description: Harvard MCB197 course, histone modifications in human tissues
Author: amandajoyward
Session Name: MCB197-histone
Genome Assembly: hg38
Creation Date: 2023-10-20
Views: 317
1697788800 317
Description: hg38 Blat of in situ hybridization probes to NTRK2.
Author: amandajoyward
Session Name: MCB197-NTRK2 probes
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 294
1698652800 294
Description: BINF 6310
Author: pavan kumar
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 316
1698652800 316
Description: Quiz 10/12
Author: jschifflin
Session Name: HTT gene assignment
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 637
1697097600 637
Description: hg38 HTT gene BIO481 - 10/12/23
Author: fareehaa_ahm
Session Name: hg38_HTT
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 483
1697097600 483
Description: hg38 genome viewing HTT gene with GENCODE V32 and Simple Repeats
Author: chelseadonovan
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 866
1697011200 866
Description: htt gene
Author: julianna0220
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 394
1697011200 394
Description: haethethntgnarangr
Author: jrkenne
Session Name: hg19_hbg
Genome Assembly: hg19
Creation Date: 2023-10-02
Views: 627
1696233600 627
Description: Hemoglobin
Author: Biniyam
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-09-28
Views: 484
1695888000 484
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD in expressed in red blood cells almost exclusively.
Author: laparidis.e
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-11-05
Views: 317
1699171200 317
Description: Methylation data for human and mouse
Author: masarun
Session Name: masa_test
Genome Assembly: hg38
Creation Date: 2023-09-21
Views: 894
1695283200 894
Description: BAF and histone markers in SS mouse model
Author: Li Li
Session Name: mouse_SS_BAF_histoneMarkers
Genome Assembly: mm10
Creation Date: 2024-06-27
Views: 155
1719475200 155
Description: Chip seq
Author: xiaopei
Session Name: Chip_seq_A
Genome Assembly: hg38
Creation Date: 2024-06-27
Views: 129
1719475200 129
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: The landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the comprehensive reference Human Genome GRCh38 , indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous peaks of microsatellite density throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of GRCh38 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,088,269,832 Total peak count: 208,638 HMDP count: 3,480 MMDP count: 26,310 LMDP count: 178,848 Session Name: Microsatellite Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: GRCh38.p14
Genome Assembly: hg38
Creation Date: 2023-09-10
Views: 159
1694332800 159
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: "The microsatellite, also called short tandem repeats (STRs), density landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the complete reference Human Genome T2T-CHM13, indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous microsatellite density peaks throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of T2T-CHM13 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,117,275,501 Total peak count: 244,729 HMDP count: 8,823 MMDP count: 36,257 LMDP count: 199,649 Microsatellites Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: CHM13v2.0
Genome Assembly: hub_3671779_hs1
Creation Date: 2023-09-10
Views: 320
1694332800 320
Description: zoom in PBK and find out all the upstream 200base SNPs
Author: ZhengJi
Session Name: hg38_upstream200SNPs
Genome Assembly: hg38
Creation Date: 2023-09-05
Views: 1001
1693900800 1001
Description: probes for FISH on human cells and tissues
Author: [email protected]
Session Name: hg19_FISH_probes
Genome Assembly: hg19
Creation Date: 2024-01-17
Views: 293
1705478400 293
Description: Crouch DRIP-Seq rDNA annotations
Author: apratim.mitra
Session Name: crouch-dripseq-rdna-annotations-diff
Genome Assembly: hub_4200124_mm10
Creation Date: 2023-08-31
Views: 20
1693468800 20
Description: class 3
Author: hekn
Session Name: “Fall23 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 431
1693468800 431
Description: Beginner Activity for UCSC Genome Browser (BIO481)
Author: fareehaa_ahm
Session Name: Fall23 Worm BIO481 group4
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 459
1693468800 459
Description: genomic 481 in class activity
Author: ryleestrother
Session Name: Fall23 Yeast BIO481 group2
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 361
1693468800 361
Description: Group Activity #1 from Group 1.
Author: jschifflin
Session Name: Fall23 Yeast BIO481 Group1
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 374
1693468800 374
Description: group 5 version of mouse project
Author: julianna0220
Session Name: Fall23 Mouse481 group5
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 360
1693468800 360
Description: Mouse genome group project group 6
Author: joshraynes
Session Name: Fall23 MouseBio481 Group 6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 329
1693468800 329
Description: Mouse genome (mm9) for Group #6 in BIO481
Author: chelseadonovan
Session Name: Fall23 Mouse BIO481 Genome Group#6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 217
1693468800 217
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: shancon1200
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-08-31
Views: 355
1693468800 355
Description: Show every Lysine site on POMC 1st extron on hg38.
Author: ZhengJi
Session Name: hg38_POMC1stextronK
Genome Assembly: hg38
Creation Date: 2023-08-31
Views: 358
1693468800 358
Description: hg18_rnaseq3
Author: hyfydky
Session Name: hg18_rnaseq3
Genome Assembly: hg18
Creation Date: 2024-05-20
Views: 174
1716192000 174
Description: Human FoxP2 gene; Fa23 Genomic class Enke
Author: renkejhsph
Session Name: hg38 Fox2P MoR Ch2 1st Person: Conservation
Genome Assembly: hg38
Creation Date: 2023-08-28
Views: 509
1693209600 509
Description: BTD MANE in HG38 UCSC browser
Author: lilinatera
Session Name: hg38_BTD_MANE
Genome Assembly: hg38
Creation Date: 2023-08-27
Views: 477
1693123200 477
Description: Clinically relevant pesudogenes sequences [high homology: orange; low homology: light orange, as per Mandelker et al. 2016; PMID: 27228465. Example: ALG1_0.26_241_1_241; Gene Name _ Mappability _ Positions <1 _ % Positions <1 _ Max contiguous bases; the 'ALG1' gene feature at position chr16:5127843-5128083, Exon+/-65bp has a 'Mappabilty score' of 0.26 (1= mapping only once to the genome whereas a score lower than 1 equates to homology else where on the genome. 241 'Positions' (bases) affected, 100'% of these Positions' and 241 'Max contiguous bases' within the Exon+/-65bp that are affected as indicated by having a mappability score below 1.
Author: Yog77
Session Name: hg19_ClinicalHomology
Genome Assembly: hg19
Creation Date: 2017-01-17
Views: 1569
1484640000 1569
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_GBR_CHS
Genome Assembly: hg19
Creation Date: 2023-08-23
Views: 54
1692777600 54
Description: 2
Author: jschifflin
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 375
1693900800 375
Description: This session is a view of the 10 capstone genes in the SSPsyGene project. It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:ARID1B ASXL3 CACNA1G CHD8 DLL1 GABRA1 KMT2C SCN2A SHANK3 SMARCC2
Author: brianlee
Session Name: Capstone_Genes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 1096
1692086400 1096
Description: This session is a view of the 10 capstone genes in the SSPsyGene project in order of chromosomes (a gene on chr2 before the gene on chr5). It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:SCN2A GABRA1 DLL1 ARID1B KMT2C SMARCC2 CHD8 CACNA1G ASXL3 SHANK3
Author: brianlee
Session Name: CapstoneGenes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 499
1692086400 499
Description: Testing public session
Author: gperez2
Session Name: Testing_public_session
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 440
1691049600 440
Description: BioInf 6310 bed file upload
Author: Neveen Mohamed
Session Name: nv23
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 347
1698739200 347
Description: ATAC-seq pile-up tracks for fruit fly clock neurons. For more details and citation: https://doi.org/10.1101/2023.08.15.553315
Author: yegeyy
Session Name: ATAC wildtype and per01 pile-up tracks
Genome Assembly: dm6
Creation Date: 2023-08-08
Views: 347
1691481600 347
Description: Test
Author: gperez2
Session Name: brca1
Genome Assembly: hg38
Creation Date: 2023-10-27
Views: 334
1698393600 334
Description: E5ind and NF54-GEXP02-Tom H3K9me3 dynamics at the onset of gam. dev.
Author: sandracula
Session Name: H3K9me3 dynamics at the onset of gam. dev.
Genome Assembly: hub_2790993_GCA_000002765.3
Creation Date: 2024-03-12
Views: 251
1710230400 251
Description: d
Author: julianna0220
Session Name: hg19 RHO JP
Genome Assembly: hg19
Creation Date: 2023-09-04
Views: 361
1693814400 361
Description: eclip comparison 2023
Author: nrpowell
Session Name: eCLIP_comparison_May_2023
Genome Assembly: hg38
Creation Date: 2023-05-23
Views: 2341
1684828800 2341
Description: This custom session includes manually selected blood-related DNA methylation data measured by bisulfite sequencing. This initial session include 121 tracks updated until 2023 June.
Author: dai905
Session Name: hg38_bloodcell_121
Genome Assembly: hg38
Creation Date: 2023-06-02
Views: 283
1685692800 283
Description: rs142783062
Author: nrpowell
Session Name: rs142783062
Genome Assembly: hg38
Creation Date: 2023-06-01
Views: 1939
1685606400 1939
Description: Epigenetic selectivity of TopoIIα redistribution and histone eviction of anthracyclines Anthracyclines act by disrupting the interface of TopoII and DNA and by evicting histones. The anthracycline-specific redistribution of TopoII and its association with histone eviction were addressed in K562 cells. Chromatin immunoprecipitation, followed by deep sequencing (ChIP-seq) against endogenously tagged TopoIIα, and transposase-accessible chromatin with sequencing (ATAC-seq) was performed 4 hours after anthracycline exposure.
Author: mtan1
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-08-11
Views: 394
1691740800 394
Description: Data Viewer
Author: allenbellamom
Session Name: hg38_DC
Genome Assembly: hg38
Creation Date: 2023-10-25
Views: 303
1698220800 303
Description: GR ChIP
Author: tsuzuki
Session Name: PC_hg38
Genome Assembly: hg38
Creation Date: 2023-05-17
Views: 2092
1684310400 2092
Description: This session describes the genomic location for LD-SNPs of rs7255249 (r2>0.8). (Top) The plot shows the eQTL association of local variants with CHST8 expression in breast mammary tissues. (Middle) GeneHancer track shows probable interactions between regulatory elements and CHST8 promoter. (Bottom) DHS region, H3K4me1, H3K4me3, and H3K27ac marks present putative epigenetic regulation. DHS signals of each cells are from ENCODE. Histone modification signals of MCF7, HMEC-1 (mammary epithelial cell, 50-year-old female), and HMEC-2 (breast epithelium, 51-year-old female) are also from ENCODE, whereas histone modification results of vHMEC (Breast_vHMEC.Donor_RM035) and BMC (Breast_Myoepithelial_Cells) are from Roadmap Epigenomics. Histone modification signals from different biosamples are grouped in order by H3K4me3, H3K4me1, and H3K27ac and presented them as overlaid tracks.
Author: Wen-Cheng
Session Name: Breast_rs7255249
Genome Assembly: hg19
Creation Date: 2023-05-18
Views: 322
1684396800 322
Description: UCSC browser session associated with manuscript: PMID: 38032818 Title: Chromosome-specific maturation of the epigenome in the Drosophila male germline
Author: jamesanderson12358
Session Name: analysis230508___UCSC_session_germline_MS
Genome Assembly: dm6
Creation Date: 2023-05-08
Views: 409
1683532800 409
Description: inputA.bed and inputA.bedgraph
Author: amykle
Session Name: inputA from usr 16
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 642
1683187200 642
Description: hugo example RTS
Author: Example
Session Name: hg38_hugo2023
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 568
1683187200 568
Description: Mouse meth
Author: danilapror
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2023-05-04
Views: 650
1683187200 650
Description: OMICS_HW_2_Sokolov_AA
Author: hazirliver1
Session Name: mm10_Sokolov_AA
Genome Assembly: mm10
Creation Date: 2023-05-03
Views: 560
1683100800 560
Description: WGBS and RNA-seq data from ENCODE - T cells - GN12878 - NK - Pancr end_OTHERS Looking at gene CD55!
Author: michalula
Session Name: WGBS_RNA_ENCODE_T_GN12878_NK_Pancr_end_OTHERS_CD55
Genome Assembly: hg38
Creation Date: 2023-05-01
Views: 786
1682928000 786
Description: PSIP ChIP (GSE175482)
Author: tsuzuki
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-04-09
Views: 1102
1681027200 1102
Description: Gene project for genetics class
Author: bji20
Session Name: Gene Project Final
Genome Assembly: hg38
Creation Date: 2023-04-07
Views: 846
1680854400 846
Description: Tracks from GSE212386. Titration of H3K9me3 and H3K27ac antibodies in ChIP, as well as replicates of H3K9me2 IPs.
Author: ari11
Session Name: GSE212386
Genome Assembly: hg38
Creation Date: 2023-04-05
Views: 760
1680681600 760
Description: CUT&RUN data for "Stress increases sperm respiration and motility in mice and men." Numbers in the sample names are associated with treatment condition as follows: Vehicle: 4, 5, 10, 12 Cort: 2, 3, 7, 8, 9
Author: nickole.kanyuch
Session Name: CUT&RUN_NM_03-2023
Genome Assembly: mm10
Creation Date: 2023-03-28
Views: 78
1679990400 78
Description: BS assay and gRNA tracks for ATRT synthetic lethal candidate genes
Author: matejboros
Session Name: hg19_custom_track
Genome Assembly: hg19
Creation Date: 2023-03-07
Views: 1003
1678176000 1003
Description: Tissue-level Atlas of Mouse Isoforms. We used full-length cDNA sequencing and the Mandalorion tool to identify and quantify high confidence transcript Isoforms for a variety of mouse tissues
Author: vollmers
Session Name: TAMI
Genome Assembly: mm39
Creation Date: 2024-01-25
Views: 484
1706169600 484
Description: gene_expression_GM12878
Author: [email protected]
Session Name: hg19_expression_GM12878
Genome Assembly: hg19
Creation Date: 2023-01-24
Views: 1196
1674547200 1196
Description: these are the 4 variants to show bruce CTs in sessions
Author: cincinnati2023
Session Name: hg38_4vars
Genome Assembly: hg38
Creation Date: 2023-01-26
Views: 598
1674720000 598
Description: Wyatt Dano Bioinformatics hands on session gene public session
Author: wpd20
Session Name: MCR1 Gene
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 321
1698048000 321
Description: Human Chromosome 22 from the Human Genome Consortium build 38 (the latest annotated reference assembly of the human genome)
Author: elittlestone
Session Name: HGC/38
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 320
1698048000 320
Description: tRNA
Author: ck-j
Session Name: tRNA
Genome Assembly: hg38
Creation Date: 2022-12-16
Views: 590
1671177600 590
Description: hg19 RHO gene with Multiz Allignments and Basewise Conservation (phyloP)
Author: chelseadonovan
Session Name: hg19 RHO Multiz Alignments
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 365
1693900800 365
Description: ChIP-seq of Histone 3 Acetylation (H3ac) marks.
Author: HanZhang-
Session Name: H3ac_ChIP
Genome Assembly: hg38
Creation Date: 2023-08-11
Views: 306
1691740800 306
Description: This data has been made public to provide access to peer reviewers
Author: VetrieLab
Session Name: BV173 ChIP Datasets_Scott et al
Genome Assembly: hg38
Creation Date: 2022-11-15
Views: 564
1668499200 564
Description: BALB/c mouse tissue level transcriptome atlas
Author: msadams
Session Name: BALB/c mouse transcriptome
Genome Assembly: mm39
Creation Date: 2022-08-09
Views: 622
1660032000 622
Description: Contribution tracks for peak 2
Author: lacey.walker
Session Name: peak2
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 2625
1665820800 2625
Description: Contribution tracks for peak 0
Author: lacey.walker
Session Name: peak0
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 1527
1665820800 1527
Description: Contribution tracks for peak 1
Author: lacey.walker
Session Name: peak1
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 620
1665820800 620
Description: Genome-wide characterization of mitochondrial DNA methylation in human brain. Matthew Devall1, Darren M. Soanes, Adam R. Smith, Emma L. Dempster, Rebecca G. Smith, Joe Burrage, Artemis Iatrou, Eilis Hannon, Claire Troakes, Karen Moore, Paul O’Neill, Safa Al-Sarraj, Leonard Schalkwyk, Jonathan Mill, Michael Weedon & Katie Lunnon The mitochondrial genome is characterized by specific regions of methylation. Graph showing average % methylation at each cytosine in the mitochondrial genome from superior temporal gyrus (STG) and cerebellum (CER) brain tissue from seven donors free of neurodegenerative disease, including three males and four females using a targeted bisulfite sequencing method.
Author: dmsoanes
Session Name: chrM_methylation_STG_CER
Genome Assembly: hg38
Creation Date: 2022-10-04
Views: 721
1664870400 721
Description: Used for CMSE 411
Author: CVan0124
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-23
Views: 569
1663920000 569
Description: HIV-1 strain NL4-3 mRNA Atlas v1 mRNA transcript models open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: [email protected] Transcript model method: Transcript models were downloaded as FASTA from GenBank:MZ242719.1-MZ242757.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. Max number of sequences for blat = 25, so n=38 was partitioned into two blat runs, sorted by accession. These were viewed as a track in UCSC Genome Browser. MZ242719.1, MZ242720.1, MZ242721.1 are models of unspliced, singly-spliced, and doubly-spliced. "Singly-spliced" and "doubly-spliced" have been commonly used in the literature, but without basis in explicitly defined mRNA models. As you can see, HIV-1 NL4-3 splice isoforms supported by high-quality long reads and reanalysis are more complicated that previously understood. Open reading frames (ORFs) method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. ORF note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. ORF note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. ORF note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_mRNA+ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-21
Views: 428
1663747200 428
Description: HIV-1 strain NL4-3 mRNA Atlas v1 open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: [email protected] Method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. Note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. Note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. Note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-20
Views: 681
1663660800 681
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_multi_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 1060
1663574400 1060
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_single_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 577
1663574400 577
Description: eCLIP experiments with ligation step allowing identification of miRNA-mRNA pairs and binding sites to around 60 nt resolution. Data generated in the laboratory of Todd Skaar.
Author: nrpowell
Session Name: miRNA_binding_sites_latest_Aug2022
Genome Assembly: hg38
Creation Date: 2022-09-01
Views: 889
1662019200 889
Description: test
Author: ez176
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-01
Views: 557
1662019200 557
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation, and includes a custom track that isolates two of these isoforms. This session also includes the transcript expression GTEx track, which shows the frequencies of SORBS1 isoform expression in different types of tissue; Hence, one is able to see how each isoform of SORBS1 is expressed at different frequencies in each tissue type. The two isoforms highlighted within the custom track are great examples of isoform expression, as they are expressed in certain tissue types at vastly different rates.
Author: education
Session Name: hg19_SORBSct
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 711
1661846400 711
Description: tracks for analysis of ERRg regulatory variants.
Author: agacita
Session Name: ERRg_basic
Genome Assembly: hg38
Creation Date: 2023-06-11
Views: 376
1686470400 376
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. OMIM has two entries showing that variants on this gene are associated with spinal anomalies. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTomim
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 840
1661846400 840
Description: The squirrel monkey genome and the TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. In monkeys, the inclusion of an exon in the mature transcript allows for formation of a tail. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: saiBol1_TBXT
Genome Assembly: saiBol1
Creation Date: 2022-08-24
Views: 676
1661328000 676
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. The "Multiz Alignment" track illustrates which primates have the AluY element and which do not. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTconservation
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 656
1661328000 656
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTalus
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 952
1661328000 952
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. For more information regarding this story, visit the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXT
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 732
1661328000 732
Description: BRCA1 gene region, showing CpG islands and DNA methylation. These regions influence gene expression. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylationAndIslands
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 673
1660896000 673
Description: DNA methylation patterns with and without bi-sulfite treatment in BRCA1 region. These DNA modifications affect gene regulation. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylation
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 646
1660896000 646
Description: Transcription factor binding sites and CpG island in BRCA1 region of human hg19 genome assembly. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_tfbs
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 694
1660896000 694
Description: DMRs and DMPs in relation to H3K4me3 signals of Acute myeloid leukemia samples
Author: bacdao
Session Name: LAML
Genome Assembly: hg38
Creation Date: 2022-08-24
Views: 408
1661328000 408
Description: POLN and HAUS3 share the first exon.
Author: Dongbo Ding
Session Name: POLN
Genome Assembly: hg19
Creation Date: 2022-08-06
Views: 623
1659772800 623
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "GWAS" track is enabled and shows common nucleotide variants in the region and provides publications that further explore the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gwas
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 687
1658390400 687
Description: .....
Author: gperez2
Session Name: rn6_atp4
Genome Assembly: rn6
Creation Date: 2022-07-26
Views: 608
1658822400 608
Description: Elys DamID in 16-18h Drosophila embryos.
Author: Shevelyov
Session Name: Elys_embryo DamID
Genome Assembly: dm3
Creation Date: 2022-12-14
Views: 543
1671004800 543
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Human Genome Diversity Project" (or "HGDP") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies and a helpful visual aid. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2hgdp
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 623
1658390400 623
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Genome Aggregation Database" (or "gnomAD") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A click into the gnomAD track gives access to their population and other data. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gnomAD
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 749
1658390400 749
Description: View of ARID1a gene with "CRISPR Targets" Data track enabled in pack mode. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education.
Author: education
Session Name: crispr_fig3
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 692
1661673600 692
Description: FGFR2 on the “UCSC Genes” and “NCBI Genes” tracks. FGFR2 is read on the opposite, negative strand, hence the leftward facing intron arrows. Different splicing events produce different isoforms of the gene. Read more about splicing in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2
Genome Assembly: hg19
Creation Date: 2022-02-24
Views: 816
1645689600 816
Description: SNAPC1 gene shown with the first exon highlighted in orange. Find a story about three reading frames in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig1
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 1117
1656316800 1117
Description: Peak file 'MCF7_E2-ethl.hpeak.out' comparing E2 and ethl-treated (control) samples.
Author: NSP
Session Name: MCF7_E2-ethl_Peaks_hg18
Genome Assembly: hg18
Creation Date: 2022-06-28
Views: 670
1656403200 670
Description: A close-up of the first exon in the SNAPC1 gene. In this session, we can see the three different frames and the different amino acid sequences each frame contains. Notice how the frame with the methionine is the only frame read for the gene, as it encodes for the start of the first exon of the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig2
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 901
1656316800 901
Description: Regions of genome detected in biofluids with at least 1 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_1
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 714
1655452800 714
Description: Regions of genome detected in biofluids with at least 5 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_5
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 953
1655452800 953
Description: This session shows the proximity of the LCT gene and two variants within the intron of the nearby MCM6 gene that affect the activity of the LCT gene -- causing persistence of lactase activity into adulthood. People with these variants can digest milk as adults. Without at least one of them, lactose intolerance results. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT_MCM6
Genome Assembly: hg19
Creation Date: 2022-06-03
Views: 714
1654243200 714
Description: This session highlights a single nucleotide change (G to A) with pathogenic consequences found within FOXP2, a gene associated with human speech and language comprehension. FOXP2's association with speech was discovered through this single nucleotide change first witnessed in the "KE family"; A pedigree in which almost half of the members for the past three generations have developed a speech disorder called verbal dyspraxia. The OMIM track is enabled and has a marker representing the nucleotide change found in the KE family pedigree. This G to A allele change results in a codon that corresponds to a different amino acid, histidine instead of the correct amino arginine (p.R553H), and results in a faulty protein which, as seen in the KE family, causes verbal dyspraxia. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2p.R553H
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 693
1652601600 693
Description: METTL3 gene zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs right to left. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.)
Author: education
Session Name: hg38_revStrandZoom2
Genome Assembly: hg38
Creation Date: 2022-06-01
Views: 671
1654070400 671
Description: METTL3 gene view zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs left to right -- which is the reverse complement of the sequence encoding the amino acids. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.) Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandZoom
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 721
1653984000 721
Description: MYC gene with exons and introns. The direction of the small intron arrows can be seen to go from left to right in the MYC gene, denoting the direction of the gene and signifying that the 5’ end is to the left and 3’ to the right (“top” strand). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_MYC
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 818
1653984000 818
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess a serine (S) in the highlighted position while the other primates present on the track have an asparagine (N). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig4
Genome Assembly: hg19
Creation Date: 2022-05-29
Views: 648
1653811200 648
Description: Editing for public
Author: QAtester
Session Name: hg38_highlight_v431_edit
Genome Assembly: hg38
Creation Date: 2022-05-26
Views: 713
1653552000 713
Description: session
Author: QAtester3
Session Name: hg19_v431
Genome Assembly: hg19
Creation Date: 2022-05-24
Views: 696
1653379200 696
Description: The PLP1 gene is shown with GTEx track, indicating the tissue specificity of gene expression. Note the high signal is brain tissues (yellow bars). The OMIM Allelic Variants track is expanded to full display mode, showing the phenotypes of variants in different locations in the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_pelizaeus
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 761
1652601600 761
Description: PLP1 gene and OMIM Allelic Variants track. Different variants result in different disease states (mouseover the OMIM Variants). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_PLP1
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 706
1652601600 706
Description: Highly conserved region in GRK4 gene. High PhyloP score for first and second nucleotides of codons reflects amino acid conservation through evolutionary time. Third base varies (wobble) because these amino acids have multiple codons -- the third base can be anything is free to diverge through time. PFAM track shows that this is a functionally significant region (protein kinase). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_wobble2
Genome Assembly: hg19
Creation Date: 2022-05-12
Views: 716
1652342400 716
Description: ChIP-seq, ATAC-seq, and RNA-seq count data from sorted porcine myeloid cells in duplicate.
Author: rcorbett
Session Name: susScr11.1_Myeloid_ChIP_ATAC
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 727
1651824000 727
Description: Quiz 1.
Author: jschifflin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 372
1693900800 372
Description: view of gene Rpl14 showing alternative splicing
Author: richardmott
Session Name: rn4.Rpl14
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 393
1690272000 393
Description: view of gene Slc39a12 showing alternative splicing
Author: richardmott
Session Name: rn4.Slc39a12
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 378
1690272000 378
Description:
Author: nannanzhao
Session Name: terc-ko
Genome Assembly: mm10
Creation Date: 2022-04-11
Views: 683
1649664000 683
Description:
Author: davem
Session Name: midterm
Genome Assembly: hg38
Creation Date: 2022-04-06
Views: 682
1649232000 682
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session also includes the two GTEx tracks, which illustrate frequencies of gene expression in different types of tissue.
Author: education
Session Name: hg19_SORBS1gtex
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 682
1648972800 682
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session is utilized on the Education page in the "splice variants" document.
Author: education
Session Name: hg19_SORBS1
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 709
1648972800 709
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess an asparagine (N) in the highlighted position while the other primates present on the track have a threonine (T). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig3
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 646
1652601600 646
Description: RHO hg19
Author: Chaffikm
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-01-26
Views: 489
1674720000 489
Description:
Author: ZC
Session Name: ATAC
Genome Assembly: hg38
Creation Date: 2022-03-25
Views: 741
1648195200 741
Description:
Author: EsterCastillo
Session Name: Paneles_VHIO_bed
Genome Assembly: hg19
Creation Date: 2022-03-25
Views: 696
1648195200 696
Description: Tracks from GEO GSE22104 Samples: GSM550303 Stat4WTTh1 GSM550304 Stat4KOTh1 GSM550305 H3K4me3WTTh1 GSM550306 H3K4me3 S4KOTh1 GSM550307 H3K27me3WTTh1 GSM550308 H3K27me3 S4KOTh1 content.txt files and bedgraph files
Author: twyss
Session Name: Chip_Stat4_Th1_Wei
Genome Assembly: mm9
Creation Date: 2024-12-13
Views: 28
1734076800 28
Description: This session shows a short match on the UTR sequence for a gene, acugcugagcugggag. If you click below the black box, into the gene page for TGDS, you can then click an "RNA Structure" link. This will bring you to a section where you can then see for the 5' UTR a "Picture" link and see how this RNA fold structure may arrange.
Author: QAtester
Session Name: RNA_plot
Genome Assembly: hg38
Creation Date: 2022-05-03
Views: 871
1651564800 871
Description: CHip
Author: xiaopei
Session Name: Chip_seq_B
Genome Assembly: hg38
Creation Date: 2024-07-01
Views: 121
1719820800 121
Description: Review in this mailing list question, https://groups.google.com/a/soe.ucsc.edu/g/genome/c/y3evkDazY2o/m/0WjoQD63BQAJ, the "How to start from scratch to find tracks" and "How to view data in the region of interest and adjust display" sections and instead of using hg38 go to "GRCm38/mm10" and then use "TF" in the track search step. Set the "JASPAR Transcription Factors" track on mm10 to "pack" and then search "Mef2C" and select "Mef2c (ENSMUST00000198199.4) at chr13:83504034-83663343" from the search results, and then zoom out "1.5x" as well. Next click into the grey box for the "JASPAR Transcription Factors Track Settings" and click the "Schema" link on the far right. By clicking the Schema link you will see the fields for the "Primary Table: jaspar2022" and from this page you can use the Tools menu to arrive at the Table Browser, so this table will be automatically selected for you. Here click the "create" button next to "filter:" and for the "score is" field set it from "ignored" to ">" for greater than and put in a value such as 700 and then click submit. Then put in the "output filename:" field a name like "mm10Jaspar_Mef2c_score700.csv" and be sure that you click the button next to "csv (for excel)" and then click "get output" to download the results. Open the resulting file in Excel.
Author: brianlee
Session Name: Shiaoching
Genome Assembly: mm10
Creation Date: 2022-03-16
Views: 677
1647417600 677
Description: Mm10 browser session associated with our manuscript "Integration of multimodal data in the developing tooth reveals candidate regulatory loci driving human odontogenic phenotypes", Frontiers in Dental Medicine, 2022
Author: emmawentworth
Session Name: mm10_all_18state
Genome Assembly: mm10
Creation Date: 2022-03-08
Views: 1227
1646726400 1227
Description:
Author: hy123
Session Name: hg38 heart 1
Genome Assembly: hg38
Creation Date: 2022-03-07
Views: 686
1646640000 686
Description:
Author: asaenz.13
Session Name: Genomics group 7 - final project
Genome Assembly: hg19
Creation Date: 2022-03-04
Views: 710
1646380800 710
Description:
Author: YKehayova
Session Name: hg19 ATAC-seq 01.03.22
Genome Assembly: hg19
Creation Date: 2022-03-01
Views: 728
1646121600 728
Description:
Author: aytyuh
Session Name: new
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 742
1644998400 742
Description:
Author: JFormosa
Session Name: 2-15-22 Hwk6pt1
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 712
1644912000 712
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "OMIM" track is enabled and shows common nucleotide variants in the region and provides information regarding the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Clicking into the OMIM track provides access to details hosted there. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2omim
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 662
1658390400 662
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "dbSNP 150" track is enabled and shows common nucleotide variants in the region. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A smaller rsID number corresponds to an earlier entry, meaning that rs671 is one of the earliest uploaded into NCBIs dbSnp database. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2dbSNP150
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 710
1658390400 710
Description:
Author: Chilliard
Session Name: hg19 - assignment 5
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 1005
1644912000 1005
Description:
Author: JFormosa
Session Name: 2-14-22 Hwk 5
Genome Assembly: hg19
Creation Date: 2022-02-14
Views: 695
1644825600 695
Description: Desiccation-induced inflammation and ocular surface disease is suppressed by terminal state MRC1 conjunctival macrophages.
Author: zhenzuo2
Session Name: MRC1_conjunctival_macrophages
Genome Assembly: mm10
Creation Date: 2024-04-23
Views: 189
1713859200 189
Description:
Author: himtiffant
Session Name: p1 t1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 938
1644393600 938
Description:
Author: helenajara10
Session Name: mm10w/ Dock6
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 719
1644393600 719
Description:
Author: aytyuh
Session Name: task 1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 710
1644393600 710
Description:
Author: helenajara10
Session Name: mm10w/interaction
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 680
1644393600 680
Description:
Author: Jcotney
Session Name: TFAP2_Enhancer_KO_Session
Genome Assembly: hg38
Creation Date: 2022-02-08
Views: 799
1644307200 799
Description:
Author: chunmei1991
Session Name: ChIPseq_peak_profile_Weilab
Genome Assembly: hg19
Creation Date: 2022-02-06
Views: 856
1644134400 856
Description: Close view of the ARID1a gene with the "CRISPR Targets" data track enabled. Filter is set to 90 to show only the best sites. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: crispr_fig5
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 637
1661673600 637
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The "dbSNP" track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. The "ClinVar" track confirms rs886040510's pathogenicity with a red box and bead. Clicking onto either of these markings will navigate you to a details page that provides more information. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopclinvar
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 635
1643875200 635
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The dbSNP track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopgain
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 906
1643875200 906
Description: This session shows a synonymous variant found on BRCA2, a gene associated with breast cancer. The nucleotide change does result in a changed amino acid. The variant in question is highlighted in turquoise. Two dbSNP tracks are enabled and provide more information about the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2synon
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 710
1643875200 710
Description: This session shows a frameshift variant (highlighted in turquoise) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. Two dbSNP tracks are enabled and provide more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frameshift
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 658
1643875200 658
Description: This session shows a frameshift variant (highlighted in turquoise, but looks pale green under the yellow highlight) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. The pale yellow highlight shows this change, AGT being the new codon after the C and T nucleotides (pale green) are deleted. This changes the reading frame from the second frame to the first frame shown on the Base Position track, which is set to full in order to visualize three potential reading frames. The red highlight marks the stop codon of this new reading frame. Therefore, this frameshift variant results in a premature stop codon. The dbSNP track is enabled and provides more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frames
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 654
1643875200 654
Description: This session shows a missense variant, highlighted in turquoise, found on BRCA2. This single nucleotide variant (SNV) changes the resulting amino acid; The original codon "CAT" codes for histidine while an individual with the variant in question would possess either the codon "CAA" or "CAG", coding for glutamine. This means the resulting polypeptide chain would be impacted. However, ClinVar's data does not label this variant as pathogenic. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2missense
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 665
1643875200 665
Description: This session shows a portion of BRCA2 (exon 11), a gene associated with breast cancer. Two dbSNP tracks are enabled and mark known variants in the region displayed. Red boxes represent variants that disrupt effective protein production (missense), while green boxes indicate that the variant does not change the resulting amino acid (synonymous). Some of these missense variants have pathogenic consequences, causing breast cancer. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2variants
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 820
1643875200 820
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: helenajara10
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 1142
1643875200 1142
Description:
Author: Kaushik
Session Name: PHOX2B
Genome Assembly: hg18
Creation Date: 2022-02-05
Views: 749
1644048000 749
Description:
Author: pwjeffries
Session Name: hg38Covert
Genome Assembly: hg38
Creation Date: 2022-02-02
Views: 720
1643788800 720
Description:
Author: katerynamarku
Session Name: Fall19 Yeast test (KM)
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 762
1643616000 762
Description:
Author: pham4tt
Session Name: Spring20 Yeat Test TM,KM,EL
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 697
1643616000 697
Description:
Author: tomgo
Session Name: mm10- enhancers
Genome Assembly: mm10
Creation Date: 2022-01-31
Views: 710
1643616000 710
Description:
Author: jos200a
Session Name: Fall 2022 Yeast Test JEAA
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 715
1643529600 715
Description:
Author: Cliffford081915
Session Name: Spring2022 Yeast Test(JDC)
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 691
1643529600 691
Description:
Author: garberla
Session Name: CGEMS yeast LG test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 843
1643184000 843
Description:
Author: ajaycox
Session Name: CGEMS yeast (AJ) test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 732
1643184000 732
Description:
Author: espinokb
Session Name: CGEMS yeast KE test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 738
1643184000 738
Description:
Author: CherryLab
Session Name: Nuclear_EyeBrowser_TrackHub
Genome Assembly: hg38
Creation Date: 2021-11-01
Views: 1132
1635753600 1132
Description:
Author: aytyuh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 936
1644393600 936
Description:
Author: YKehayova
Session Name: hg19 SBNO1 project
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 754
1642665600 754
Description:
Author: Pey.davoodi
Session Name: Optional
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 681
1644220800 681
Description:
Author: Pey.davoodi
Session Name: 4-genes-workshop
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 729
1644220800 729
Description:
Author: YKehayova
Session Name: hg19 ATAC peaks COLGALT2 promoter
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 774
1642579200 774
Description: ChIP, ATAC, and RNA-seq counts for sorted porcine myeloid cells in duplicate, along with H3K27ac and H3K4me3 data from other cell types for comparison.
Author: rcorbett
Session Name: susScr11_Myeloid_ChIP_ATAC_comparison
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 758
1651824000 758
Description: CAG repeats in the HTT gene. Expansion of the CAG repeats leads to Huntington's disease. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: htt_main
Genome Assembly: hg19
Creation Date: 2022-01-13
Views: 839
1642060800 839
Description: A session highlighting two single-nucleotide variants found in introns 9 and 13 of the MCM6 gene, located upstream from the LCT gene, that impact whether or not an individual is lactase persistent as an adult. Both the OMIM and GWAS tracks have marked these variants as phenotypically relevant to the appearance of lactase persistence. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 966
1640419200 966
Description:
Author: dxliucmu
Session Name: hg38_ ChIP with H3K4me1 in HC vs SCZ (one pair))
Genome Assembly: hg38
Creation Date: 2022-01-09
Views: 693
1641715200 693
Description:
Author: JFormosa
Session Name: Hwk6Pt1
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 678
1645516800 678
Description: Human CD14+ monocytes bivalent genes identified from ENCSR267NWZ, and ENCSR000ASK respectively for H3K4me3 (GSM1003536) and H3K27me3 (GSM1003564) ChIP-seq data sets.
Author: teetoonet
Session Name: Human CD14+ monocytes bivalent genes
Genome Assembly: hg19
Creation Date: 2023-03-02
Views: 440
1677744000 440
Description: UCLA 2022 workshop -- custom tracks Alus from dbRIP not in rmsk; CAT gene with two names, some SNPs from 151 missense and intron
Author: Example
Session Name: hg19_snp_CAT_Alus
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 737
1642665600 737
Description:
Author: ani_davis
Session Name: Spring22 Yeast Test AND
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 730
1643616000 730
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq6
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 776
1640419200 776
Description: ATG5 intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 797
1640246400 797
Description: MAP3K7 intron Author: Mustafi P Session Name: ATAC-seq2 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq2
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 819
1640246400 819
Description: UVRAG promoter-TSS Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq1
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 858
1640246400 858
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq PC4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 763
1640246400 763
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seq5 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq5
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 775
1640246400 775
Description: YEATS2 intron TSS Author: Mustafi P Session Name: ATAC-seq3 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq3
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 764
1640246400 764
Description: Close-up view if transition zone between a coding and a non-coding region of the virus. Note the High conservation in the PhyloP track in the protein-coding region. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_pconserv
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 608
1640160000 608
Description: Ebola virus VP24 gene with PhyloP track showing high conservation in the protein-coding region among 160+ isolates. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_phylop
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 806
1640160000 806
Description: Ebola virus genome showing vp24 gene region. The PhyloP track shows that the 100+ strains of ebola and Marburg have conservation in the protein-coding region of the gene. Pink color indicates a positive value above the display level in the track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_vp24
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 649
1640160000 649
Description: Zoomed-in view of ebolavirus L protein showing serine codon in the reference that is different in many islolates distantly related to it (lower part of figure). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_codon
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 644
1640160000 644
Description: Full genome of the ebola virus showing a blat alignment of the Marburg virus. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_blatsearch
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 630
1640160000 630
Description: Full genome of ebola virus showing proteins in the top track and conservation among several outbreaks in the lower tracks. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_mainsession
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 678
1640160000 678
Description: Visualization of the BRCA1 Gene, CpG islands and DNA methylations in different cell lines using the bisulfite Seq and Methyl 450k method.
Author: art_03m
Session Name: hg19: Methylation & CpG islands in BRCA1 gene
Genome Assembly: hg19
Creation Date: 2021-12-18
Views: 489
1639814400 489
Description:
Author: adelaidetovar
Session Name: apoa2
Genome Assembly: hg38
Creation Date: 2021-12-13
Views: 696
1639382400 696
Description:
Author: SKellaway
Session Name: dnFOSforSNPs
Genome Assembly: hg38
Creation Date: 2021-12-08
Views: 739
1638950400 739
Description:
Author: Schne2lk
Session Name: hg38 NRL multiomics
Genome Assembly: hg38
Creation Date: 2021-12-07
Views: 738
1638864000 738
Description:
Author: marielgr
Session Name: ACSS2_ChIPseq
Genome Assembly: mm39
Creation Date: 2021-12-17
Views: 678
1639728000 678
Description: Aging MapR data in photoreceptor neurons. Loaded bigwig track correspond to the averaged signal for each aging time point generated from three independent biological replicates
Author: juanjaureguilozano
Session Name: dm6_agingMapR
Genome Assembly: dm6
Creation Date: 2021-12-01
Views: 9418
1638345600 9418
Description: A pipeline for predicting cardiac gene network components using cis-regulatory elements (CREs) Manuscript: Hieu T. Nim*, Louis Dang*, Harshini Thiyagarajah*, Daniel Bakopoulos, Michael See, Natalie Charitakis, Tennille Sibbritt, Michael P. Eichenlaub, Stuart K. Archer, Nicolas Fossat, Richard E. Burke, Patrick P. L. Tam, Coral G. Warr‡, Travis K. Johnson‡#, Mirana Ramialison‡#. "Predicting genes essential for heart development irrespective of their spatial expression pattern". Genome Biology (in press). (*: co-first authors; ‡: co-senior authors; #: corresponding authors)
Author: nimt0001
Session Name: CardiacNetworkComponentPredictor
Genome Assembly: mm9
Creation Date: 2021-11-30
Views: 945
1638259200 945
Description:
Author: latimeaa
Session Name: Hg38 HISAT2 Retina tracks
Genome Assembly: hg38
Creation Date: 2021-11-30
Views: 768
1638259200 768
Description:
Author: Eldar
Session Name: SNV
Genome Assembly: hg38
Creation Date: 2021-02-16
Views: 1104
1613462400 1104
Description:
Author: Eldar
Session Name: CNV
Genome Assembly: hg38
Creation Date: 2021-02-25
Views: 1288
1614240000 1288
Description:
Author: aigul
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-18
Views: 800
1637222400 800
Description:
Author: Wen-Cheng
Session Name: Liver_APOA5p
Genome Assembly: hg19
Creation Date: 2020-11-04
Views: 1405
1604476800 1405
Description:
Author: zunpengliu66
Session Name: WT H3K9me3 ChIP-seq
Genome Assembly: hg38
Creation Date: 2021-11-11
Views: 703
1636617600 703
Description:
Author: randa2jl
Session Name: Human retina multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 727
1637049600 727
Description:
Author: young_researcher
Session Name: hg19_intersection
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 1034
1636272000 1034
Description:
Author: young_researcher
Session Name: hg19_H3F3A
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 878
1636272000 878
Description:
Author: vladislav
Session Name: intersect_with_DeepZ
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 728
1636185600 728
Description:
Author: vladislav
Session Name: H3F3A.merge
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 768
1636185600 768
Description:
Author: vladislav
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 890
1636185600 890
Description:
Author: megallegos
Session Name: Independent Project Link
Genome Assembly: hg19
Creation Date: 2021-11-05
Views: 1149
1636099200 1149
Description:
Author: randa2jl
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 764
1636012800 764
Description:
Author: Schne2lk
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 782
1636012800 782
Description:
Author: Schne2lk
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1274
1636012800 1274
Description:
Author: Schne2lk
Session Name: mm9 thrb
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 768
1636012800 768
Description:
Author: randa2jl
Session Name: wt/nrl CBRs
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1141
1636012800 1141
Description:
Author: laarne
Session Name: CHIP SEQ ACTUAL SESSION CBR
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 788
1636012800 788
Description:
Author: Schne2lk
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 794
1636012800 794
Description:
Author: adityabhagwate
Session Name: bw_upload
Genome Assembly: hg19
Creation Date: 2021-11-03
Views: 802
1635926400 802
Description:
Author: ashleywilkins
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1216
1635840000 1216
Description:
Author: sweatbr
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 778
1635840000 778
Description:
Author: sweatbr
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 968
1635840000 968
Description:
Author: randa2jl
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1271
1635840000 1271
Description:
Author: ashleywilkins
Session Name: Cardiomyopathy
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 833
1635840000 833
Description:
Author: Schne2lk
Session Name: hg19 DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 751
1635840000 751
Description:
Author: randa2jl
Session Name: hg19-RHO custom track
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 723
1635840000 723
Description:
Author: Schne2lk
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 792
1635840000 792
Description:
Author: sweatbr
Session Name: RIDLEY
Genome Assembly: hg38
Creation Date: 2021-11-04
Views: 767
1636012800 767
Description:
Author: randa2jl
Session Name: Fall21 HTT gene Huntingtons
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 925
1634630400 925
Description:
Author: Schne2lk
Session Name: hg38 HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 772
1634630400 772
Description:
Author: whaleycn
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 778
1634630400 778
Description:
Author: JuliaLaz
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-18
Views: 825
1634544000 825
Description:
Author: ashleywilkins
Session Name: hg38 HTT GENE
Genome Assembly: hg38
Creation Date: 2021-10-17
Views: 1007
1634457600 1007
Description:
Author: CherryLab
Session Name: VISIONS_TrackHub
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 888
1634284800 888
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Parth Doshi
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 30
1730880000 30
Description:
Author: yoni.arndt
Session Name: ex.1 RAC1
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 805
1634284800 805
Description:
Author: randa2jl
Session Name: Fall21 HGD gene
Genome Assembly: hg38
Creation Date: 2021-10-14
Views: 750
1634198400 750
Description:
Author: sweatbr
Session Name: chr3chimp
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 883
1634025600 883
Description:
Author: randa2jl
Session Name: Fall21 HumanChr2 JennaRandall
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 1020
1634025600 1020
Description:
Author: JFormosa
Session Name: Hwk6Pt4b
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 675
1645516800 675
Description:
Author: JFormosa
Session Name: Hwk6Pt4a
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 692
1645516800 692
Description:
Author: mjliddi16
Session Name: hg19_assignment6
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 1077
1645516800 1077
Description: BINF6310
Author: Rahulprasad Selvaraj
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-08
Views: 294
1699430400 294
Description:
Author: tboisjol
Session Name: TB-98358724-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-08
Views: 974
1633680000 974
Description:
Author: [email protected]
Session Name: RLBase
Genome Assembly: hg38
Creation Date: 2021-10-06
Views: 2184
1633507200 2184
Description:
Author: [email protected]
Session Name: RLBase_slow
Genome Assembly: hg38
Creation Date: 2021-10-05
Views: 939
1633420800 939
Description:
Author: kkaczor
Session Name: tamer_hiv_atac
Genome Assembly: hg38
Creation Date: 2021-09-30
Views: 1042
1632988800 1042
Description:
Author: kkaczor
Session Name: tamer_hiv_rna
Genome Assembly: hg38
Creation Date: 2021-09-29
Views: 990
1632902400 990
Description:
Author: laarne
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 797
1634630400 797
Description:
Author: areynolds
Session Name: hg38 HBB-LCR
Genome Assembly: hg38
Creation Date: 2021-09-20
Views: 919
1632124800 919
Description:
Author: jschlachetzki
Session Name: 20210917_4DBSM_Schlachetzki
Genome Assembly: hg19
Creation Date: 2021-09-17
Views: 744
1631865600 744
Description:
Author: layla13
Session Name: TSA2R38 Group #4
Genome Assembly: hg19
Creation Date: 2021-09-16
Views: 767
1631779200 767
Description:
Author: Thijs
Session Name: Wnt_human_NGS_20210914_V2
Genome Assembly: hg38
Creation Date: 2021-09-14
Views: 985
1631606400 985
Description:
Author: mallorycunningham
Session Name: TASR38 group3
Genome Assembly: hg19
Creation Date: 2021-09-12
Views: 955
1631433600 955
Description:
Author: noycohen
Session Name: HepG2 and K562 Methylation
Genome Assembly: hg38
Creation Date: 2021-09-12
Views: 1087
1631433600 1087
Description:
Author: msadams
Session Name: A549
Genome Assembly: hg38
Creation Date: 2021-09-28
Views: 729
1632816000 729
Description:
Author: xuxing
Session Name: multi-Paired-seq
Genome Assembly: hg38
Creation Date: 2021-10-31
Views: 783
1635667200 783
Description:
Author: jessicagarth
Session Name: TAS2R38 group4
Genome Assembly: hg19
Creation Date: 2021-09-08
Views: 944
1631088000 944
Description:
Author: hayes22
Session Name: Fall21 Yeast Test JEH
Genome Assembly: sacCer3
Creation Date: 2021-09-08
Views: 946
1631088000 946
Description:
Author: SamanthaBusch
Session Name: Fall21 Yeast test SIB
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 996
1631001600 996
Description:
Author: Siddeldj
Session Name: Fall19 yeast test DJS
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 971
1631001600 971
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 986
1631001600 986
Description:
Author: Albert Cheng
Session Name: hg38_Cas9_1_0_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 914
1631001600 914
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 963
1631001600 963
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1220
1631001600 1220
Description:
Author: JuliaLaz
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-07
Views: 1117
1631001600 1117
Description:
Author: AbigailLambert
Session Name: Fall19 Yeast test AML
Genome Assembly: sacCer3
Creation Date: 2021-09-12
Views: 901
1631433600 901
Description:
Author: layla13
Session Name: Fall21 Yeast test LA
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 951
1630828800 951
Description:
Author: gucascau
Session Name: H3-3-2
Genome Assembly: mm10
Creation Date: 2021-09-03
Views: 946
1630656000 946
Description:
Author: mallorycunningham
Session Name: Fall21 Yeast Test MC
Genome Assembly: sacCer3
Creation Date: 2021-09-03
Views: 954
1630656000 954
Description:
Author: jessicagarth
Session Name: CGEMS yeast JMG test
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 947
1630569600 947
Description:
Author: JuliaLaz
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 723
1630569600 723
Description:
Author: latimeaa
Session Name: CGEMS Worm AAL test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 893
1630569600 893
Description:
Author: latimeaa
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 775
1630569600 775
Description:
Author: aazari99
Session Name: CGEMS Worm AA Test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1016
1630569600 1016
Description:
Author: aazari99
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 759
1630569600 759
Description:
Author: Schne2lk
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 734
1630569600 734
Description:
Author: laarne
Session Name: CGEMS worm LAN test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 930
1630569600 930
Description:
Author: whaleycn
Session Name: Fall21 Mouse Test Group(6)
Genome Assembly: mm9
Creation Date: 2021-09-02
Views: 920
1630569600 920
Description:
Author: ashleywilkins
Session Name: Fall21 Worm test group #4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 790
1630569600 790
Description:
Author: randa2jl
Session Name: Fall21 Yeast Test Group 1
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 900
1630569600 900
Description:
Author: asinerbc
Session Name: FAll21 Yeast test group 2
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 942
1630569600 942
Description:
Author: AHRImmunity
Session Name: stockingerg_ATACSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1018
1630483200 1018
Description:
Author: AHRImmunity
Session Name: stockingerg_CHIPSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1108
1630483200 1108
Description:
Author: Eldar
Session Name: gene level
Genome Assembly: hg38
Creation Date: 2021-08-27
Views: 974
1630051200 974
Description:
Author: aytyuh
Session Name: newnew
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 708
1644998400 708
Description:
Author: ssdhar
Session Name: hg19 Pim1 Bc
Genome Assembly: hg19
Creation Date: 2021-08-25
Views: 1028
1629878400 1028
Description:
Author: zxtzhangqian
Session Name: Lamprey_WGBS
Genome Assembly: petMar3
Creation Date: 2021-08-25
Views: 959
1629878400 959
Description:
Author: schmi4am
Session Name: Fall19 Yeast test AMS
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 940
1630828800 940
Description:
Author: ssdhar
Session Name: hg19 mmp11 bc
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 965
1629187200 965
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac six1
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 936
1629187200 936
Description:
Author: lyj
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-08-15
Views: 930
1629014400 930
Description:
Author: lyj
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-15
Views: 1186
1629014400 1186
Description: H3K27ac ChIP-seq count data from A375 melanoma in response to medium-chain fatty acid (octanoate) administration.
Author: thuang316
Session Name: H3K27ac_ChIP_seq_octanoate
Genome Assembly: hg38
Creation Date: 2021-08-15
Views: 723
1629014400 723
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2022
Genome Assembly: hg38
Creation Date: 2021-08-11
Views: 3344
1628668800 3344
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_mm10_ReMap2022
Genome Assembly: mm10
Creation Date: 2021-08-11
Views: 2012
1628668800 2012
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_dm6_ReMap2022
Genome Assembly: dm6
Creation Date: 2021-08-11
Views: 1295
1628668800 1295
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_araTha1_ReMap2022
Genome Assembly: hub_2961057_araTha1
Creation Date: 2021-08-11
Views: 2031
1628668800 2031
Description: This session uses Times font.
Author: brianlee
Session Name: Times_Font
Genome Assembly: hg38
Creation Date: 2021-08-10
Views: 3249
1628582400 3249
Description: A Public Session using the Avant Guard Font.
Author: brianlee
Session Name: AvantG_Font
Genome Assembly: hg19
Creation Date: 2021-08-10
Views: 2283
1628582400 2283
Description: 4931406C07Rik Transcripts
Author: szaman2
Session Name: 4931406C07Rik
Genome Assembly: mm10
Creation Date: 2021-08-10
Views: 917
1628582400 917
Description:
Author: jamesli
Session Name: RNA_ATAC_Cerebellum1
Genome Assembly: mm10
Creation Date: 2021-08-06
Views: 754
1628236800 754
Description:
Author: gucascau
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-05
Views: 1014
1628150400 1014
Description: Sessions shows part of spike protein on SARS-CoV-2 genome. One track shows the reference amino acids for the spike protein. A custom track at the top shows the location of two amino acids that are substituted by prolines to hold the protein in the pre-fusion conformation. A track near the bottom shows the Moderna and Pfizer/BioNtech vaccines with the two prolines substituted for lysine and valine of the reference. The last rack shows current variants of concern (VoC). Reconfigure the vaccine track to see the "different RNA bases" by clicking the gray button to the left of track.
Author: Example
Session Name: wuhCor1_ProPro2
Genome Assembly: wuhCor1
Creation Date: 2021-08-04
Views: 986
1628064000 986
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells alomst exclusively.
Author: EJ
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-03
Views: 1015
1627977600 1015
Description:
Author: gonzalezvl
Session Name: pha_v1_ncbi
Genome Assembly: hub_2958085_pha_v1_ncbi
Creation Date: 2021-08-02
Views: 1035
1627891200 1035
Description:
Author: nkfarah
Session Name: snATAC_cerebellum_E12_14
Genome Assembly: mm10
Creation Date: 2021-07-27
Views: 960
1627372800 960
Description: The gene HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, where as HBD is expressed in red cells almost exclusively.
Author: mw1278
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-31
Views: 919
1630396800 919
Description: This session has Times font selected and italic styling applied, available from the Genome Browser menu -> Configure page (or "c f" shortcut).
Author: PublicSessions
Session Name: Drosophila Duplication with font
Genome Assembly: dm6
Creation Date: 2021-07-21
Views: 906
1626854400 906
Description:
Author: jmorlan66
Session Name: PFS_session8
Genome Assembly: hg38
Creation Date: 2021-07-20
Views: 964
1626768000 964
Description:
Author: Hanson258
Session Name: H3K27me3_myoblast
Genome Assembly: hg38
Creation Date: 2021-07-16
Views: 990
1626422400 990
Description: chıpseq result
Author: [email protected]
Session Name: hazals.
Genome Assembly: hg38
Creation Date: 2024-06-12
Views: 133
1718179200 133
Description:
Author: Jinkil_Jeong
Session Name: Shig_Ad
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 979
1625644800 979
Description:
Author: MatthewMurry
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2021-07-07
Views: 948
1625644800 948
Description:
Author: smorabito
Session Name: AD_snATAC
Genome Assembly: hg38
Creation Date: 2021-07-07
Views: 1538
1625644800 1538
Description: Human HOX 11 gene mapped on the positive RLFS readings in the bed file.
Author: arazavi1
Session Name: HOX
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 983
1625644800 983
Description: This variant affecting Type 1 collagen is identified as a genetic basis for classical EDS and vascular EDS from this source: https://www.ehlers-danlos.com/eds-types/ This session displays SNV clinically oriented annotation tracks at this locus. A paper describing these tracks and the feature that launches them, "Variant Interpretation: UCSC Genome Browser Recommended Track Sets" is in press (pre-print here: https://www.authorea.com/users/423801/articles/529043-variant-interpretation-ucsc-genome-browser-recommended-track-sets)
Author: Kate
Session Name: Ehlers-Danlos Syndrome COL5A1 variant locus (c.934C>T)
Genome Assembly: hg19
Creation Date: 2021-07-08
Views: 1057
1625731200 1057
Description:
Author: Albert Cheng
Session Name: hg38_JACKIE
Genome Assembly: hg38
Creation Date: 2021-07-01
Views: 975
1625126400 975
Description:
Author: Albert Cheng
Session Name: mm10_JACKIE
Genome Assembly: mm10
Creation Date: 2021-07-01
Views: 1004
1625126400 1004
Description: A picture of an assembly hub for Zebu cattle where the current DNA in the region has been sent to the External Tool RSAT Metazoa which discovered a motif, aaacttatagata, within the region. The motif was then highlighted with the Short Match track. The session shows how building assembly hubs enables interoperability with tools beyond the UCSC Genome Browser. To access the External Tools pop-up menu, when browsing a genome hover over the "View" menu and then select External Tools.
Author: PublicSessions
Session Name: ExternalTools
Genome Assembly: hub_2100979_GCF_000247795.1
Creation Date: 2021-07-23
Views: 1125
1627027200 1125
Description:
Author: ashleywilkins
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 932
1630915200 932
Description:
Author: Schne2lk
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2021-09-06
Views: 931
1630915200 931
Description:
Author: artman1967
Session Name: hg19_IBR finale 061521
Genome Assembly: hg19
Creation Date: 2021-06-15
Views: 987
1623744000 987
Description:
Author: Shevelyov
Session Name: LaminDamID in SpG and SpCs
Genome Assembly: dm3
Creation Date: 2021-06-12
Views: 1061
1623484800 1061
Description:
Author: PolinaKananykina
Session Name: polina_kananykina
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 952
1623225600 952
Description:
Author: labashmanov
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1042
1623225600 1042
Description:
Author: PolinaKananykina
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 954
1623225600 954
Description:
Author: art591
Session Name: hse21_H3K27ac_MCF-7_human
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 945
1623225600 945
Description: THRB
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 151
1712736000 151
Description: PDE6A
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 170
1712736000 170
Description: RHO edit
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 156
1712736000 156
Description:
Author: xiaolinwei123
Session Name: hg38_gata6
Genome Assembly: hg38
Creation Date: 2021-05-26
Views: 908
1622016000 908
Description:
Author: Xenia
Session Name: DNA methilarion 14chr
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 987
1621843200 987
Description:
Author: gemtang
Session Name: histone
Genome Assembly: hg38
Creation Date: 2021-06-04
Views: 955
1622793600 955
Description:
Author: Maksimov_Denis
Session Name: RNA_seq
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 1021
1621843200 1021
Description: Regions on GRCh37 where discordant exome variant calls are enriched when mapped on GRCh38.
Author: mdawood
Session Name: DISCREPS_GRCh37
Genome Assembly: hg19
Creation Date: 2021-05-17
Views: 1226
1621238400 1226
Description: Regions on GRCh38 where discordant exome variant calls are enriched when mapped on GRCh37.
Author: mdawood
Session Name: DISCREPs_GRCh38
Genome Assembly: hg38
Creation Date: 2021-05-17
Views: 1164
1621238400 1164
Description:
Author: jojobajo
Session Name: SarkisyanA
Genome Assembly: mm10
Creation Date: 2021-05-17
Views: 1020
1621238400 1020
Description:
Author: manu90
Session Name: paciente2_trasloca
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 1002
1620806400 1002
Description:
Author: manu90
Session Name: ZMIZ
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 1263
1620806400 1263
Description:
Author: Maksimov_Denis
Session Name: chromatine states
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 1007
1620720000 1007
Description: tRNA2
Author: ck-j
Session Name: tRNA2
Genome Assembly: hg38
Creation Date: 2022-12-27
Views: 526
1672128000 526
Description:
Author: eva re
Session Name: mm10_er
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 977
1620633600 977
Description:
Author: eva re
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 964
1620633600 964
Description:
Author: jdpachec
Session Name: Pacheco-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-05-01
Views: 983
1619856000 983
Description:
Author: amatsiev
Session Name: Matsiev-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1002
1619769600 1002
Description:
Author: kailasdhond
Session Name: BME 110 PS 2
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1325
1619769600 1325
Description:
Author: mbule
Session Name: Bule-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1018
1619769600 1018
Description:
Author: mai.baker
Session Name: hg38_SAT1_bed
Genome Assembly: hg38
Creation Date: 2021-04-28
Views: 998
1619596800 998
Description:
Author: beoungle
Session Name: hg19 enhancer and infos
Genome Assembly: hg19
Creation Date: 2021-04-26
Views: 1710
1619424000 1710
Description:
Author: ramace
Session Name: Mace--PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-25
Views: 935
1619337600 935
Description:
Author: Maksimov_Denis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 974
1620720000 974
Description:
Author: abenet
Session Name: HumanMutationFig2
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1031
1621411200 1031
Description:
Author: abenet
Session Name: HumanMutationFig4
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1008
1621411200 1008
Description:
Author: gaotc200
Session Name: mockIP_ce11
Genome Assembly: ce11
Creation Date: 2021-04-19
Views: 1074
1618819200 1074
Description:
Author: gaotc200
Session Name: mockIP_dm6
Genome Assembly: dm6
Creation Date: 2021-04-19
Views: 999
1618819200 999
Description:
Author: jojshelt
Session Name: ACE 2 04/17/21
Genome Assembly: hg38
Creation Date: 2021-04-17
Views: 992
1618646400 992
Description:
Author: jojshelt
Session Name: SARS CoV 2 04/15/21
Genome Assembly: wuhCor1
Creation Date: 2021-04-15
Views: 3189
1618473600 3189
Description:
Author: gatupovmikhail
Session Name: mm10_hw1
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 2704
1618387200 2704
Description:
Author: Maksimov_Denis
Session Name: bisulfite sequencing
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 998
1618387200 998
Description: Public session with the basic tracks to identify putative endothelial enhancers, as described in the published method chapter: Neal A, Rodriguez-Caro H, De Val S. Finding and Verifying Enhancers for Endothelial-Expressed Genes. Methods Mol Biol. 2022;2441:351-368. doi: 10.1007/978-1-0716-2059-5_28. PMID: 35099751. If used, please cite the publication. Author: Helena Rodriguez-Caro
Author: HRC
Session Name: AngiogenesisProtocol_2021_DeVal
Genome Assembly: hg19
Creation Date: 2021-04-09
Views: 1046
1617955200 1046
Description:
Author: qscmki
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2021-04-08
Views: 1101
1617868800 1101
Description:
Author: gbenegas
Session Name: tabulamuris
Genome Assembly: mm10
Creation Date: 2021-04-06
Views: 1155
1617696000 1155
Description:
Author: gbenegas
Session Name: primarymotorcortex
Genome Assembly: mm10
Creation Date: 2021-04-06
Views: 1135
1617696000 1135
Description:
Author: JFormosa
Session Name: Hwk6Pt3
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 670
1645516800 670
Description: This session shows a heat map display using bigBed tracks. A new bigHeat python program helps build a heat-map style display of tracks in various colors. It takes an input BED file and an expression-matrix and generates one bigBed file per column, colored by the values in the matrix. For SARS-2 there are assays where peptides are spotted onto a microarray and antibodies extracted from blood are run over the array and the bigHeat tool was created to aid in visualizing this microarray type data into a collection of stacked tracks in the Browser seen in this session.
Author: brianlee
Session Name: HeatMap
Genome Assembly: wuhCor1
Creation Date: 2021-04-06
Views: 1004
1617696000 1004
Description:
Author: ldebiasio
Session Name: DeBiaso-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-27
Views: 972
1619510400 972
Description:
Author: marijazzz
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-03-28
Views: 1070
1616918400 1070
Description:
Author: asalisbury1
Session Name: mm9999
Genome Assembly: mm9
Creation Date: 2021-03-25
Views: 1059
1616659200 1059
Description:
Author: vrlopez
Session Name: Spring 22 Yeast test VL
Genome Assembly: sacCer3
Creation Date: 2022-01-28
Views: 703
1643356800 703
Description:
Author: Cornelia
Session Name: danRer10_pEGFP-N1_RNA
Genome Assembly: danRer10
Creation Date: 2021-03-04
Views: 1050
1614844800 1050
Description:
Author: butlertj3
Session Name: sars_cov2_g4_stem-loops
Genome Assembly: wuhCor1
Creation Date: 2020-11-26
Views: 1275
1606377600 1275
Description: This session shows ChIP-on-ChEP-seq data from Macaca fascicularis testis for H3K27Ac, REC8, RAD21L, SMC1B, STAG3, CTCF, and BORIS/CTCFL. Data in this session are from the PNAS paper: A. Boukaba, J. Liu, C. Ward, Q. Wu1, A. Arnaoutov, J. Liang1, E. M. Pugacheva, M. Dasso, V. Lobanenkov, M. Esteban, and A. V. Strunnikov (2022) Ectopic expression of meiotic cohesin generates chromosome instability in cancer cell line. Proc Natl Acad Sci U S A. Oct 4;119(40):e2204071119. doi: 10.1073/pnas.2204071119.
Author: Strunnik
Session Name: cohesins_CTCF_BORIS_K27Ac_macFas5_pub
Genome Assembly: macFas5
Creation Date: 2021-02-28
Views: 743
1614499200 743
Description:
Author: jhj981111
Session Name: Pde4b
Genome Assembly: mm10
Creation Date: 2021-03-02
Views: 1036
1614672000 1036
Description:
Author: Mohamed Hisham
Session Name: hg19-HBB
Genome Assembly: hg19
Creation Date: 2021-03-02
Views: 1008
1614672000 1008
Description:
Author: veronicaburns
Session Name: mm10_210225
Genome Assembly: mm10
Creation Date: 2021-02-25
Views: 1163
1614240000 1163
Description:
Author: abenet
Session Name: HumanMutationFig3
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 982
1621411200 982
Description:
Author: elencampoy
Session Name: HsInv0124
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1161
1614153600 1161
Description:
Author: elencampoy
Session Name: HsInv1057
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1248
1614153600 1248
Description:
Author: elencampoy
Session Name: HsInv1051
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1236
1614153600 1236
Description:
Author: elencampoy
Session Name: HsInv0830
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1005
1614153600 1005
Description:
Author: elencampoy
Session Name: HsInv0403
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1154
1614153600 1154
Description:
Author: elencampoy
Session Name: HsInv0397
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1053
1614153600 1053
Description:
Author: elencampoy
Session Name: HsInv0395
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1008
1614153600 1008
Description:
Author: elencampoy
Session Name: HsInv0393
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 990
1614153600 990
Description:
Author: elencampoy
Session Name: HsInv0390
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1046
1614153600 1046
Description:
Author: elencampoy
Session Name: hsinv0389
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 987
1614153600 987
Description:
Author: elencampoy
Session Name: HsInv0370
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1037
1614067200 1037
Description:
Author: elencampoy
Session Name: HsInv1124
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1047
1614067200 1047
Description:
Author: elencampoy
Session Name: HsInv0290
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1008
1614067200 1008
Description:
Author: arthurcheng
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-02-20
Views: 1016
1613808000 1016
Description: Genome-wide profiling of histone H1 variants and H3K9me3 in T47D-MTVL cells upon multiple H1 depletion.
Author: NSP
Session Name: GSE156036_GSE166645
Genome Assembly: hg19
Creation Date: 2020-09-08
Views: 1334
1599552000 1334
Description:
Author: elencampoy
Session Name: HsInv0786
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1047
1613635200 1047
Description:
Author: elencampoy
Session Name: HsInv0344
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 996
1613635200 996
Description:
Author: elencampoy
Session Name: HsInv0340
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1033
1614067200 1033
Description:
Author: elencampoy
Session Name: HsInv0228
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 995
1614067200 995
Description:
Author: elencampoy
Session Name: HsInv0396
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1019
1613548800 1019
Description:
Author: elencampoy
Session Name: hsinv0097
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1032
1613548800 1032
Description: Posterior Column Ataxia with Retinitis Pigmentosa (PCARP) is a genetic disorder caused by mutations in the FLVCR1 gene that codes for Feline Leukemia Virus Subgroup C Cellular Receptor 1. Mutations in this heme transport protein, can lead to heme toxicity which affects vision and the nervous system. Symptoms begin in childhood and can include Tunnel-like visual loss, night blindness, and photophobia. Through adulthood sensory function decreases, and symptoms of atrophy, loss of touch, and scoliosis, are common. There are four variants of the FLVCR1 gene that cause PCARP. Puffenburger et. al identified a novel variant at position 361 of the FLCR1 gene, an Asparagine-to-Aspartic Acid, missense mutation which is highlighted blue. The Puffenburger variant (blue) is the current focus of the track, if you zoom to see the whole FLVCR gene you will see there are three other variants designated by the OMIM Alleles Track. Two additional variants are also located in exon 1, and a third in exon 8. At position 574 there is a variant resulting in a cysteine-to-arginine missense mutation which is highlighted green, and at position 721, an alanine-to-threonine missense mutation which is highlighted yellow. In Exon 8 at position 1477 there is a variant resulting in a glycine-to-arginine missense mutation. The Clinvar Variants track classifies all four as pathogenic missense mutations. Pathogenic and Likely Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The Conservation track shows that the regions where all four variants are highly conserved across several species. There is no amino acid variation between chimps, dogs, cattle, cattle, mice, fowl, and zebrafish. Conservation across all of these species indicates these regions are important to vertebrates, and explains why these missense mutations are damaging.
Author: jrhemm
Session Name: Juniata Bioinformatics JHNH
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 1051
1613030400 1051
Description: This session shows bosTau9 for a gene also found in Human_PIK3CG which was described in a PAG 2020 meeting.
Author: brianlee
Session Name: bosTau9_Human_PIK3CG
Genome Assembly: bosTau9
Creation Date: 2021-02-12
Views: 1006
1613116800 1006
Description:
Author: soniagoozee
Session Name: bushbaby
Genome Assembly: hg38
Creation Date: 2021-02-11
Views: 936
1613030400 936
Description:
Author: elencampoy
Session Name: inversions
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 994
1613030400 994
Description:
Author: raceschaeffer
Session Name: mm10_task2_int
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1029
1612944000 1029
Description:
Author: raceschaeffer
Session Name: mm10_task1
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1397
1612944000 1397
Description:
Author: joel_mundkl
Session Name: Alg 13 w/ tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1076
1612944000 1076
Description:
Author: joel_mundkl
Session Name: All 3 tracks session
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1007
1612944000 1007
Description:
Author: joel_mundkl
Session Name: Gli3 and HH tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1227
1612944000 1227
Description:
Author: joel_mundkl
Session Name: Gli3 limb binding mm10 (ptch1)
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1002
1612944000 1002
Description:
Author: qhernand
Session Name: Hernandez-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1208
1619769600 1208
Description:
Author: alecmilazzo
Session Name: mm10_1
Genome Assembly: mm10
Creation Date: 2021-02-09
Views: 1436
1612857600 1436
Description:
Author: as3838
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1055
1612771200 1055
Description:
Author: PaoloM1990
Session Name: ACTB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1444
1612252800 1444
Description:
Author: mdrcetin
Session Name: hg38_encode_bcell_cd34myeloidprogenitor_naturalkiller
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 729
1637049600 729
Description:
Author: mdrcetin
Session Name: hg38_encode_ucsf4_hyyees64_h1_h9
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 1229
1637049600 1229
Description:
Author: mdrcetin
Session Name: hg38_k562_encode_minus_strand_only
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 730
1637049600 730
Description:
Author: molcov
Session Name: Human Duplication
Genome Assembly: hg19
Creation Date: 2021-01-31
Views: 1078
1612080000 1078
Description: coronavirus spike protein region with some relevant tracks turned on, including variants of concern (VoC).
Author: Example
Session Name: wuhCor1_spike
Genome Assembly: wuhCor1
Creation Date: 2021-01-25
Views: 3332
1611561600 3332
Description:
Author: Dongyao_Liu
Session Name: mm9_BAML1_and_CLOCK
Genome Assembly: mm9
Creation Date: 2021-04-13
Views: 988
1618300800 988
Description: The hub shows association of copy number changes of VNTRs (Variable Number Tander Repeat) with local gene expression and CpG methylation in two discovery cohorts ane one replication cohort for which PCR-free Illumina WGS data were available.<br> Read more here: https://gargp01.u.hpc.mssm.edu/ucsc_exp_meth_vntr.html
Author: brianlee
Session Name: VNTR
Genome Assembly: hg19
Creation Date: 2021-01-22
Views: 1048
1611302400 1048
Description:
Author: elencampoy
Session Name: Hsinv0209
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1033
1614067200 1033
Description:
Author: elencampoy
Session Name: HsInv0030
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1011
1614067200 1011
Description:
Author: BOPOHDR
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1465
1610438400 1465
Description:
Author: ashleywilkins
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 926
1630915200 926
Description: CAG repeats found in the RUNX2 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig9
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 604
1660896000 604
Description: Zoom in on CAG repeats found in the gene MED12. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig7
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 622
1660896000 622
Description: Two different areas of CAG repeats found in the MED12 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig6
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 689
1660896000 689
Description:
Author: as3838
Session Name: PATRICKDATA
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1088
1612771200 1088
Description:
Author: AnnaClaireR1
Session Name: mm10_3tracks
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1253
1612166400 1253
Description:
Author: AnnaClaireR1
Session Name: mm10_testupload
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1097
1612166400 1097
Description:
Author: PaoloM1990
Session Name: GAPDH_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1060
1612252800 1060
Description:
Author: PaoloM1990
Session Name: ATP6V0E1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1033
1612252800 1033
Description:
Author: PaoloM1990
Session Name: GBA_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1104
1612252800 1104
Description:
Author: PaoloM1990
Session Name: CTSD_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1004
1612252800 1004
Description:
Author: PaoloM1990
Session Name: CTSB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1136
1612252800 1136
Description:
Author: PaoloM1990
Session Name: CTSL_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1036
1612252800 1036
Description:
Author: PaoloM1990
Session Name: MCOLN1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1147
1612252800 1147
Description:
Author: AnnaClaireR1
Session Name: mm10_smoc
Genome Assembly: mm10
Creation Date: 2021-02-02
Views: 1293
1612252800 1293
Description: This session helps demonstrate the Simple Tandem Repeats by TRF track. It includes a Short Match track that is simply highlighting the sequence <b>ctctcgct</b> within the window and this reflects how a programmatic approach can annotate the genome, where the Tandem Repeats Finder (TRF) program helps discover and annotate possibly imperfect repeats as well as exact matches. Users who are interested in STRs may want to look at a resource called STRBase https://strbase.nist.gov/index.htm which was founded in 2001 and includes a Variant Allele Reports page for those searching for allele or frequency count information.
Author: brianlee
Session Name: hg38_STR
Genome Assembly: hg38
Creation Date: 2021-01-07
Views: 1355
1610006400 1355
Description: This session shows an assembly hub on mink that can be loaded with this quick link: https://genome.ucsc.edu/h/GCA_900108605.1<br> The link can also be searched with the position= term: https://genome.ucsc.edu/h/GCA_900108605.1?position=ACE2 <br> It can also have custom data displayed on it, in this case an interact file that can be loaded under My Data and Custom Tracks.
Author: brianlee
Session Name: Mink_hub_interact
Genome Assembly: hub_2637617_GCA_900108605.1
Creation Date: 2021-01-07
Views: 1310
1610006400 1310
Description:
Author: sarahjc
Session Name: FM GR ChIP Miseq
Genome Assembly: hg38
Creation Date: 2021-01-02
Views: 1213
1609574400 1213
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV_2
Genome Assembly: hg19
Creation Date: 2020-12-21
Views: 1208
1608537600 1208
Description:
Author: Libby3121
Session Name: mm39 FoxA2 sites
Genome Assembly: mm39
Creation Date: 2020-12-20
Views: 1174
1608451200 1174
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV
Genome Assembly: hg19
Creation Date: 2020-12-19
Views: 1642
1608364800 1642
Description:
Author: solbru
Session Name: hg19_TANGO6
Genome Assembly: hg19
Creation Date: 2020-12-18
Views: 1288
1608278400 1288
Description:
Author: molcov
Session Name: Drosophila Duplication
Genome Assembly: dm6
Creation Date: 2021-01-30
Views: 1101
1611993600 1101
Description:
Author: joliemb
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-02-04
Views: 1070
1612425600 1070
Description:
Author: mongerc
Session Name: mm10BMI1
Genome Assembly: mm10
Creation Date: 2020-12-16
Views: 1246
1608105600 1246
Description:
Author: rpe13002
Session Name: hg38_CT83_iso3
Genome Assembly: hg38
Creation Date: 2020-12-13
Views: 1377
1607846400 1377
Description:
Author: rpe13002
Session Name: hg38_TMPRSS4_iso4
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1217
1607760000 1217
Description:
Author: rpe13002
Session Name: hg38_CT83
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1210
1607760000 1210
Description:
Author: rpe13002
Session Name: hg38_ADAM9_iso27
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1214
1607760000 1214
Description:
Author: rpe13002
Session Name: hg38_ITGA6_iso20
Genome Assembly: hg38
Creation Date: 2020-12-12
Views: 1237
1607760000 1237
Description:
Author: mongerc
Session Name: Brien2020AllTracks
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1273
1607328000 1273
Description:
Author: mongerc
Session Name: Brien2020ChIP-RX
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1190
1607328000 1190
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_multi_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 1784
1605340800 1784
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_single_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 1581
1605340800 1581
Description:
Author: sarahjc
Session Name: Nextseq Dedup ESF BAC SS 113020
Genome Assembly: hg38
Creation Date: 2020-11-30
Views: 1219
1606723200 1219
Description:
Author: ustiugova_al
Session Name: au
Genome Assembly: hg38
Creation Date: 2020-11-27
Views: 1229
1606464000 1229
Description:
Author: ck-j
Session Name: RNAseq-WT/KO-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-21
Views: 746
1605945600 746
Description:
Author: ck-j
Session Name: PCPB1-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-17
Views: 772
1605600000 772
Description: KJ8Vehicle = 0d +TGFB KJ15eEMT = 2d +TGFB KJ12pEMT = 4d +TGFB KJ14Trans = 4d +TGFB followed by 4d TGFB withdrawal KJ11fMET2 = 4d +TGFB followed by 10d TGFB withdrawal KJ9fEMT = 10d +TGFB KJ13pMET = 10d +TGFB followed by 4d TGFB withdrawal KJ10fMET1 = 10d +TGFB followed by 10d TGFB withdrawal
Author: kelsey_johnson1
Session Name: Reversible EMT ATAC-seq peaks
Genome Assembly: hg19
Creation Date: 2020-11-20
Views: 1085
1605859200 1085
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: RNAseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1278
1605168000 1278
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: ChIPseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1266
1605168000 1266
Description:
Author: kkaczor
Session Name: cirm_ucla_2
Genome Assembly: hg38
Creation Date: 2020-11-11
Views: 1290
1605081600 1290
Description:
Author: jranish
Session Name: Castrillo LXR ChIP
Genome Assembly: mm10
Creation Date: 2020-10-27
Views: 976
1603785600 976
Description:
Author: zgtman
Session Name: Genescan_3_hg38_SRY
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1438
1610438400 1438
Description:
Author: manu90
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-11-15
Views: 967
1605427200 967
Description:
Author: evechen97
Session Name: EC-39545454-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-10
Views: 918
1633852800 918
Description:
Author: aurbanow
Session Name: tammer
Genome Assembly: mm10
Creation Date: 2020-11-25
Views: 1267
1606291200 1267
Description:
Author: [email protected]
Session Name: BAC_FOSMID
Genome Assembly: mm9
Creation Date: 2020-10-16
Views: 1481
1602835200 1481
Description:
Author: psharma
Session Name: 6. PS-75227116-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-06
Views: 1176
1601971200 1176
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite-2
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 796
1633593600 796
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 860
1633593600 860
Description:
Author: fushenchu
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-09-28
Views: 1298
1601280000 1298
Description:
Author: federikr
Session Name: CRX
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1294
1601280000 1294
Description: ClinGen tracks show dosage sensitivity (deletion or gains will cause disease or not) of described copy number region (ISCA) and single genes in the region and curation of association of diseases to the genes in these region.
Author: abenet
Session Name: clinical-ClinGenCuration
Genome Assembly: hg19
Creation Date: 2020-09-25
Views: 1298
1601020800 1298
Description:
Author: zahra jafari
Session Name: homwork
Genome Assembly: hg19
Creation Date: 2021-12-03
Views: 701
1638518400 701
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "ClinVar" track is enabled and shows common nucleotide variants in the region. Clicking into a rsID provides more information regarding the phenotypic, and possibly pathogenic, consequences of a variant. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2clinvar
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 612
1658390400 612
Description:
Author: williamhconrad
Session Name: TSS-evaluation
Genome Assembly: hg19
Creation Date: 2020-09-21
Views: 1672
1600675200 1672
Description:
Author: kianayaghoobian
Session Name: TAS2R38 UniProt
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1272
1600588800 1272
Description:
Author: kianayaghoobian
Session Name: TAS2R38 group1
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1639
1600588800 1639
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH_1
Genome Assembly: hg19
Creation Date: 2020-09-14
Views: 1344
1600070400 1344
Description:
Author: manu90
Session Name: TAD!!
Genome Assembly: hg19
Creation Date: 2021-06-03
Views: 963
1622707200 963
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH
Genome Assembly: hg19
Creation Date: 2020-09-12
Views: 1332
1599897600 1332
Description:
Author: zgtman
Session Name: OTOA
Genome Assembly: hg38
Creation Date: 2021-10-11
Views: 896
1633939200 896
Description:
Author: rstarks23
Session Name: e9.5Placenta_HistoneModification
Genome Assembly: mm10
Creation Date: 2020-09-09
Views: 1272
1599638400 1272
Description:
Author: AMOza
Session Name: LMM_Conservation
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 1355
1599638400 1355
Description:
Author: maddieevans9
Session Name: TAS2R38 group(ME,BZ,CB)
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 2000
1599638400 2000
Description:
Author: gage2ea
Session Name: Fall20 Worm test group 3
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1345
1599552000 1345
Description:
Author: sconyejekwe
Session Name: Fall20 Mouse test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1073
1599552000 1073
Description:
Author: calvinc98
Session Name: Fall20 Mouse test group 6
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1278
1599552000 1278
Description:
Author: occamslaser
Session Name: Fall20 Worm test group# 4
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1084
1599552000 1084
Description:
Author: hrbaylous
Session Name: Fall20 yeast test group 1
Genome Assembly: sacCer3
Creation Date: 2020-09-08
Views: 1420
1599552000 1420
Description:
Author: Haley Yandrasitz
Session Name: Fall20 Mouse Test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1227
1599552000 1227
Description:
Author: jzhicks07
Session Name: CGEMS yeast JMH test
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1279
1599465600 1279
Description:
Author: biologyassignment
Session Name: Fall19 Yeast test (ACG)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1346
1599465600 1346
Description:
Author: ArcherS
Session Name: Fall19 Yeast test A.S.
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1249
1599465600 1249
Description:
Author: federikr
Session Name: Fall20 TAS2R38 group#3
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1138
1599465600 1138
Description:
Author: perryts
Session Name: Fall20 Yeast Test (TSP)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1274
1599465600 1274
Description:
Author: maddieevans9
Session Name: Fall20 Yeast test (ME)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1335
1599465600 1335
Description:
Author: lauren_soleo
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1300
1599465600 1300
Description:
Author: brockse
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1285
1599465600 1285
Description:
Author: Chadtb220
Session Name: Fall19 Yeast test CTB
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1325
1599465600 1325
Description:
Author: AMOza
Session Name: LMM_Conservation_hg38
Genome Assembly: hg38
Creation Date: 2020-09-09
Views: 7023
1599638400 7023
Description:
Author: kianayaghoobian
Session Name: Fall19 Yeast test KY
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1496
1599465600 1496
Description:
Author: KeelynCrossin
Session Name: Fall20 yeast test KGC
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1244
1599379200 1244
Description:
Author: JFormosa
Session Name: Hwk6Pt2
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 652
1645516800 652
Description:
Author: embdukes
Session Name: Fall20 Yeast test (EDB)
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1336
1599379200 1336
Description:
Author: napace
Session Name: Fall19 Yeast test NAP
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1457
1599379200 1457
Description:
Author: federikr
Session Name: Fall20 Yeast Test KF
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1312
1599379200 1312
Description:
Author: JRozick147
Session Name: wuhCor1-1
Genome Assembly: wuhCor1
Creation Date: 2020-09-05
Views: 1641
1599292800 1641
Description:
Author: lauren_soleo
Session Name: Fall20 Yeast test LS
Genome Assembly: sacCer3
Creation Date: 2020-09-04
Views: 1289
1599206400 1289
Description: This session is of the new ALFA (Allele Frequency Aggregator) variants and allele frequency hub. Results from the Allele Frequency Aggregator (ALFA) project will help users interpret the biological impact of common and rare sequence variants. ALFA's initial release includes analysis of genotype data from ~100K unrestricted dbGaP subjects and provides high-quality allele frequency data now displayed on relevant dbSNP records. Eventually ALFA will analyze more than 1M subjects. The current version is for hg38/GRCh38 with work to include hg19/GRCh37 data. Read more about the ALFA project page here: https://www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa
Author: brianlee
Session Name: ALFA_Trio
Genome Assembly: hg38
Creation Date: 2020-09-03
Views: 1808
1599120000 1808
Description:
Author: brockse
Session Name: Fall20 Yeast Test SB
Genome Assembly: sacCer3
Creation Date: 2020-08-31
Views: 1444
1598860800 1444
Description:
Author: Yuanyuan Zhang
Session Name: Mechanism of 5mC controlled Arabidopsis clock pace
Genome Assembly: hub_329263_araTha1
Creation Date: 2021-01-11
Views: 3462
1610352000 3462
Description:
Author: mongerc
Session Name: mm10Suz12
Genome Assembly: mm10
Creation Date: 2020-08-28
Views: 1312
1598601600 1312
Description: A stop codon (marked in red) found at the end of the METTL3 gene, indicating the end of translation, which proceeds right to left for this gene. Below, we can observe how conservation decreases dramatically after the Stop codon in the “PhyloP” data track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_stop
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 687
1642579200 687
Description:
Author: alfordml
Session Name: Spring22 Yeast test MA
Genome Assembly: sacCer3
Creation Date: 2022-01-25
Views: 727
1643097600 727
Description:
Author: gera912
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-08-11
Views: 1309
1597132800 1309
Description:
Author: feng xue
Session Name: kdm4c
Genome Assembly: hg17
Creation Date: 2020-08-10
Views: 1586
1597046400 1586
Description:
Author: shuynhs
Session Name: SH-61951083-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-05
Views: 1284
1601884800 1284
Description: Session of ASHG 2020 Figure 2. Displays Hi-C track format with custom display options (score normalization, display color, arc display).
Author: Lou
Session Name: ASHG2
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1345
1601884800 1345
Description: Session of ASHG 2020 Figure 1. Displays Hi-C track format with default settings. Additional tracks include UCSC Genes, ChIP-seq signal track from ENCODE, and GeneHancer clustered interactions.
Author: Lou
Session Name: ASHG1
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1312
1601884800 1312
Description:
Author: boothc
Session Name: Fish n Chips detailed
Genome Assembly: danRer10
Creation Date: 2020-08-04
Views: 1362
1596528000 1362
Description:
Author: elencampoy
Session Name: HsInv0573
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1028
1613635200 1028
Description:
Author: jzhicks07
Session Name: CRX 9.28 JMH
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1289
1601280000 1289
Description:
Author: simonwang612
Session Name: Ying_ATAC_GSDMD
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1684
1595491200 1684
Description:
Author: simonwang612
Session Name: Ying_ATACseq_peaks
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1730
1595491200 1730
Description:
Author: simonwang612
Session Name: atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1446
1595491200 1446
Description:
Author: simonwang612
Session Name: mm10_atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1297
1595491200 1297
Description:
Author: Lachlan Coin
Session Name: dRNA
Genome Assembly: hg38
Creation Date: 2020-07-22
Views: 1368
1595404800 1368
Description: Tracks associated with: Buzzi et al. 2022 Sox8 remodels the cranial ectoderm to generate the ear
Author: alexthiery
Session Name: Sox8_otic_reprogramming
Genome Assembly: galGal6
Creation Date: 2021-03-02
Views: 495
1614672000 495
Description:
Author: Marie-José
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-28
Views: 1566
1595923200 1566
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/smad3 new promoters
Genome Assembly: hg19
Creation Date: 2020-07-27
Views: 1385
1595836800 1385
Description:
Author: Schne2lk
Session Name: hg38 RHO multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 794
1637049600 794
Description:
Author: ashleywilkins
Session Name: hg38 retinal multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 725
1637049600 725
Description:
Author: chalie102
Session Name: HDA_ChIP_H3K18ac
Genome Assembly: sacCer3
Creation Date: 2021-02-15
Views: 1427
1613376000 1427
Description:
Author: [email protected]
Session Name: hg38_NTRK2_blat_probes
Genome Assembly: hg38
Creation Date: 2020-10-12
Views: 1477
1602489600 1477
Description:
Author: LalehEbr
Session Name: hg19 UCSC workshop assignment
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1689
1595145600 1689
Description:
Author: fatemeh sadat
Session Name: F
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1715
1595145600 1715
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/dastjerdi
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 1827
1594972800 1827
Description:
Author: fatemeh sadat
Session Name: FASc
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1944
1595145600 1944
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/Smad3 promoter
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 1416
1594972800 1416
Description: Transcript structures for LncExpDB and LncBook databases
Author: lizhao
Session Name: lncexpdb_UCSC
Genome Assembly: hg38
Creation Date: 2023-09-07
Views: 98753
1694073600 98753
Description: MetamORF: A repository of unique small Open Reading Frames identified by both experimental and computational approaches for gene-level and meta analyses
Author: schoteau
Session Name: MetamORF (hg38)
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1407
1594713600 1407
Description:
Author: mongerc
Session Name: Brien2020ChipRX
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1363
1594281600 1363
Description:
Author: mongerc
Session Name: Brien2020RNASeq
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1432
1594281600 1432
Description:
Author: mongerc
Session Name: Brien2020ATAC
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1376
1594281600 1376
Description:
Author: Marie-José
Session Name: hg19_TAD
Genome Assembly: hg19
Creation Date: 2020-07-09
Views: 1737
1594281600 1737
Description:
Author: Stephanie
Session Name: hg19-OXTR
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1387
1594195200 1387
Description: RCRN
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RCRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 141
1712736000 141
Description:
Author: Stephanie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-07-08
Views: 1375
1594195200 1375
Description:
Author: Chen Chunpeng
Session Name: GBM_STAT
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1323
1594713600 1323
Description:
Author: Stephanie
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1535
1594195200 1535
Description:
Author: ranjan99
Session Name: RCas9_HSA_IM
Genome Assembly: mm10
Creation Date: 2020-06-28
Views: 1730
1593331200 1730
Description:
Author: ustiugova_al
Session Name: cd27
Genome Assembly: hg38
Creation Date: 2020-06-26
Views: 1388
1593158400 1388
Description:
Author: ccpowell
Session Name: solLy4
Genome Assembly: hub_2266061_solLy4
Creation Date: 2020-06-15
Views: 2107
1592208000 2107
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1585
1592467200 1585
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1360
1592467200 1360
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K36me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1332
1592467200 1332
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1275
1592467200 1275
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1423
1592467200 1423
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, K4me2
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1307
1592467200 1307
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3Kme1
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1265
1592467200 1265
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H4me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1348
1592467200 1348
Description:
Author: jeramiahsmith
Session Name: RNAseq_regen_compil
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-06-17
Views: 1568
1592380800 1568
Description:
Author: williamhconrad
Session Name: hg19 HCT116 DMR Methylation
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1558
1591689600 1558
Description:
Author: nickeener
Session Name: SARS-CoV-2 Selection
Genome Assembly: wuhCor1
Creation Date: 2020-06-03
Views: 1398
1591171200 1398
Description:
Author: [email protected]
Session Name: ce10_OP_CNV
Genome Assembly: ce10
Creation Date: 2020-06-01
Views: 1508
1590998400 1508
Screenshot not available
Click Here to view
Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPI_hg38
Genome Assembly: hg38
Creation Date: 2020-06-01
Views: 1508
1590998400 1508
Screenshot not available
Click Here to view
Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPICARD_hg38
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1596
1590825600 1596
Screenshot not available
Click Here to view
Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_CARD
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1403
1590825600 1403
Description: Zoomed in on the first exon of the METTL3 gene. If we look at the direction of translation/arrows on the introns, we can see that translation for this gene is going from right to left. Zooming in here, the methionine start codon, colored in green, is observable. Notice how the sequence upstream from the start codon (to the right) is an untranslated region, depicted as a half-height box at the UTR region of the 5’ end. Offscreen to the right is more non-coding RNA (indicated by double white arrows). Only after the start codon does translation actually begin in the right-to-left direction. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_exon1
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 711
1642579200 711
Description: ChIPmera
Author: CGRoque
Session Name: GouveiaRoque_ChIPmera
Genome Assembly: hg38
Creation Date: 2021-04-22
Views: 527
1619078400 527
Description:
Author: ccpowell
Session Name: solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-25
Views: 1484
1590393600 1484
Description:
Author: [email protected]
Session Name: ce10_CNV_10kb_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1503
1589702400 1503
Description:
Author: [email protected]
Session Name: ce10_CNV_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1457
1589702400 1457
Description:
Author: m1kss
Session Name: mouse chr16 methylation embryonic
Genome Assembly: mm10
Creation Date: 2020-05-13
Views: 1486
1589356800 1486
Description:
Author: yael porat
Session Name: myc
Genome Assembly: hg38
Creation Date: 2020-05-10
Views: 1435
1589097600 1435
Description: RNA plus-sense secondary structure prediction by Rangan et al are displayed. Both MEA secondary structured and MSA conserved sequences are formatted as separate tracks. All instances of "CUAAAC" motifs are annotated (plus-sense purple, negative-sense teal, complement GUUUAG) Yellow highlights represent hypothesized negative or complement interactions. Orange highlights represent non-canonical template switching overlapping with regions with high confidence secondary structure predictions. Blue highlights represent canonical TRS-L TRS-B template switching.
Author: jssim
Session Name: wuhCor
Genome Assembly: wuhCor1
Creation Date: 2020-04-23
Views: 1584
1587628800 1584
Description:
Author: apacis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-05-06
Views: 1900
1588752000 1900
Description:
Author: Annaneed
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-07-06
Views: 1376
1594022400 1376
Description:
Author: tsvid
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 896
1632729600 896
Description:
Author: aoludipe
Session Name: hg19_kishimoto 1998
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 1217
1632729600 1217
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Difference in tracks results from strictness of parameterisations (Allelic PValue, read coverage) used when calling SNPs.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele union
Genome Assembly: wuhCor1
Creation Date: 2020-04-26
Views: 1590
1587888000 1590
Description:
Author: tmitchell1
Session Name: SNCG with EXON2 CT and CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1413
1586937600 1413
Description:
Author: tmitchell1
Session Name: SNCB CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1784
1586937600 1784
Description:
Author: tmitchell1
Session Name: SNCG CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1529
1586937600 1529
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac Her3
Genome Assembly: hg19
Creation Date: 2021-08-16
Views: 1038
1629100800 1038
Description:
Author: kianayaghoobian
Session Name: CRISPR
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1264
1601280000 1264
Description:
Author: tmitchell
Session Name: WT and mutant on CFTR
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1540
1585900800 1540
Description:
Author: tmitchell
Session Name: WT and Mutant on Guca1b
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1374
1585900800 1374
Description:
Author: tmitchell
Session Name: WT and mutant on Guca1a
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1547
1585900800 1547
Description:
Author: tmitchell
Session Name: WT and Mutant CRX
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1415
1585900800 1415
Description:
Author: tmitchell
Session Name: MAPT mutation custom track
Genome Assembly: hg38
Creation Date: 2020-04-03
Views: 1416
1585900800 1416
Description:
Author: tmitchell
Session Name: Exonic seq Custom Track
Genome Assembly: hg19
Creation Date: 2020-04-03
Views: 1427
1585900800 1427
Description:
Author: liaohy
Session Name: RNAseq_Xia.L_Control_Cex
Genome Assembly: hg19
Creation Date: 2020-04-01
Views: 1481
1585728000 1481
Description:
Author: liaohy
Session Name: RNAseq_Lin.XT_AM20191204
Genome Assembly: hg38
Creation Date: 2020-04-01
Views: 1503
1585728000 1503
Description:
Author: Genomedx
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-04-09
Views: 1823
1586419200 1823
Description:
Author: tmitchell
Session Name: WT and Mutant Arr3
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1410
1585900800 1410
Description:
Author: andre2tj
Session Name: 3/31_Lab_Assignment_1
Genome Assembly: hg19
Creation Date: 2020-03-31
Views: 1632
1585641600 1632
Description:
Author: liaohy
Session Name: RNAseq_Lian.JB_AM20200311-01
Genome Assembly: hg38
Creation Date: 2020-03-30
Views: 1466
1585555200 1466
Description:
Author: sajjeev
Session Name: ICR_CMYC_optimization_03262020
Genome Assembly: hg19
Creation Date: 2020-03-26
Views: 1598
1585209600 1598
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_RNAseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 622
1585123200 622
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part2
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 632
1585123200 632
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 649
1585123200 649
Description:
Author: ChPreuss
Session Name: MODEL_AD_NONCODING_VARIANTS_PRIORITIZATION
Genome Assembly: hg19
Creation Date: 2020-03-24
Views: 1585
1585036800 1585
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis of Human and Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_hg38
Genome Assembly: hg38
Creation Date: 2019-08-28
Views: 4309
1566979200 4309
Description: METTL3 gene on human assembly hg38, showing a gene transcribed from the negative, or lower strand. You can see the exon numbering if you mouse over the exons on either end of the gene. The 5-end of the gene is on the right. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandGene
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 679
1653984000 679
Description:
Author: fengtao-cau
Session Name: susScr11
Genome Assembly: susScr11
Creation Date: 2020-03-10
Views: 1583
1583827200 1583
Description:
Author: apodgorny
Session Name: RNA_Seq
Genome Assembly: hg38
Creation Date: 2021-08-04
Views: 1021
1628064000 1021
Description: “Spliced ESTs” data track set to pack showing varying gene arrangements for the FGFR2 gene. Each EST is labeled with the corresponding tag to the left of its sequence. CN402795 sequence read is missing exon 6 for the FGFR2 gene (yellow highlight). In the orange highlighted region, we can see two more splice variants BE706533 and BE147547 missing exon 7. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2_highlights
Genome Assembly: hg19
Creation Date: 2022-02-28
Views: 667
1646035200 667
Description:
Author: jeramiahsmith
Session Name: JS_structure_02262020
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-02-26
Views: 1313
1582704000 1313
Description:
Author: celiagonzalez98
Session Name: Team Work 2
Genome Assembly: hg19
Creation Date: 2020-02-24
Views: 1550
1582531200 1550
Description:
Author: celiagonzalez98
Session Name: Team Work
Genome Assembly: hg38
Creation Date: 2020-02-24
Views: 1463
1582531200 1463
Description:
Author: Fu Haifeng
Session Name: Primed VS Naive
Genome Assembly: mm10
Creation Date: 2020-02-21
Views: 1459
1582272000 1459
Description:
Author: chend8
Session Name: ATAC_150_intergenic_5
Genome Assembly: dm6
Creation Date: 2020-02-19
Views: 1752
1582099200 1752
Description:
Author: vinayswamy
Session Name: DNTX
Genome Assembly: hg38
Creation Date: 2020-02-17
Views: 1584
1581926400 1584
Description:
Author: Tamira
Session Name: Mouse ECR
Genome Assembly: hg19
Creation Date: 2020-02-17
Views: 1633
1581926400 1633
Description:
Author: gaguil17
Session Name: Intersection.
Genome Assembly: mm10
Creation Date: 2020-02-16
Views: 1472
1581840000 1472
Description:
Author: celiagonzalez98
Session Name: class 4 part 2
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1678
1581580800 1678
Description:
Author: celiagonzalez98
Session Name: class 4 part 1
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1688
1581580800 1688
Description:
Author: UxueHuarte
Session Name: my sesion
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1430
1581580800 1430
Description:
Author: dmr2928
Session Name: Daniel Robertson
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1512
1581494400 1512
Description:
Author: AdrianFer
Session Name: Intersected_Updated
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1540
1581494400 1540
Description:
Author: gaguil17
Session Name: Fgf17
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1844
1581494400 1844
Description:
Author: ManteoAndrade
Session Name: bejeranofoxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1462
1581494400 1462
Description:
Author: celiagonzalez98
Session Name: class 3 part 2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1465
1581494400 1465
Description:
Author: celiagonzalez98
Session Name: class 2 enviar
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1680
1581408000 1680
Description:
Author: mecay.1
Session Name: Session 2 final
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1528
1581408000 1528
Description:
Author: JonMatas
Session Name: GenoPractice 2 Public
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1658
1581408000 1658
Description: Juniata Bioinformatics Infantile Parkinsonism – dystonia is the second most popular neurodegenerative disorder. It is followed by Alzheimer. This disease is present in infancy and prevent those affected to live past their teenage year. This disease is fatal and has a second name known as Transporter deficiency Syndrome (DTDS). Those individuals that are affected may have many problem; limb dyskinesia, dystonia, and chorea, (OMIM,1). Currently we do not have an effective treatment to treat Infantile Parkinsonism-dystonia. This genetic mutation shows an increase between HVA and 5-HIAA in the cerebrospinal fluid. This leads to an increase in dopamine to serotonin metabolites, (OMIN,1).
Author: mmendez
Session Name: Juniata Bioinformatics; MM & NP
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1199
1581321600 1199
Description: Set of publicly available tracks to define enhance regions used in the human left ventricle. Accompanies Gacita et al, 2020.
Author: agacita
Session Name: Gacita_et_al_LV_Enhancer_Tracks
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 2133
1581321600 2133
Description:
Author: Andy20UNAV
Session Name: SESION2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1733
1581408000 1733
Description:
Author: irish
Session Name: Example_Diana_gtfassemblyW1_w2
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 2382
1581321600 2382
Description: Juniata Bioinformatics BMKJ The original encoded protein functions as a transcriptional coactivator that increases c-Myc activity and inhibits transforming growth factor-beta (TGF-beta) and nuclear factor kappa-B (NF-kB) signaling. The encoded protein also regulates the stability of cyclin D1 mRNA and may play a role in cell proliferation and cancer progression. There is only one novel variant of this gene, and it is GLU366GLY. In the Puffenberger paper, they used a tool called PolyPhen-2, which can be found on Harvard's website, said the substitution was "probably damaging" with a score of 0.99. Some common characteristics expressed from the mutation are psychomotor delay, intractable seizures/epilepsy, bulbous nose, wide mouth and tongue, broad jaw, short hands, short tapered fingers, and broad thumbs. The first track pictured below shows a graph that serves as a basis for the predicted alternative splicing transcripts shown in the SIB Genes track. The blocks represent exons and the lines indicate introns. Also, there is a vertex for each splice, start, and end. The graph under the previous track shows the relationship between genetic variation and gene expression in multiple human tissues.
Author: bmiller913
Session Name: SNIP1 BMKJ
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1489
1581235200 1489
Description: Children with Usher’s syndrome show no problems during infancy but begin to lose their ability to hear and see during childhood. Patients also present with mild lower body abnormalities. Charles Bonnet syndrome may also occur after affected children contract an infectious illness. Charles Bonnet syndrome is characterized by “decreased visual acuity and vivid visual hallucinations.” Usher’s syndrome is caused by a missense mutation on the 454 position of the Histidyl-tRNA synthetase (HARS) gene in which a tyrosine is replaced with an serine. The normal function of HARS is to charge tRNA with a histidine amino acid. Evidence suggests that the mutation that causes Usher’s syndrome may change the recognition of tRNA codons and/or catalytic activity. The Conservation track shows that this region is conserved across several species, and has amino acid variation in two of these species: Zebrafish (M instead of Y) and Lamprey (V instead of Y). Conservation across a number of species suggests that this region is essential to many vertebrates, and is perhaps why a mutation of this region is so detrimental. The CRISPR targets track shows DNA sequences that are targetable by CRISPR RNA guides. This track is able to show an estimate of how efficient the cleavage would be at the site (Green is the highest) as well as how specific the 20-mer primer is to a specific site in the genome (Black is least specific to just that site). This could be helpful when exploring options for gene therapy or modifications to the gene. The ClinVar Variants track shows the positions of variants in the ClinVar database. This track comes with two subtracks: one for long variants (100 bp or more, most of which are copy number variants) and one for short variants (less than 100 bp). The short variant track color codes variants according to their pathogenicity. Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The long variant track color code variants according to whether the variant is a copy number gain or loss. A user can click on a variant to find more information about the variant including a report that contains an interpretation of the variant and peer reviewed citations.
Author: behreka20
Session Name: Juniata Bioinformatics KB, LL, CM
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1506
1581235200 1506
Description: The tracks in the Synonymous Constraint Public Hub represent regions of protein-coding sequences in which the rate of synonymous substitutions during mammalian evolution has been significantly lower or higher than in the rest of that gene. There are two tracks: Synonymous Constraint Elements (SCEs) have had lower than normal synonymous substitution rates while Synonymous Acceleration Elements (SAEs) have had higher than normal rates. Thanks to Maxim Wolf, Irwin Jungreis and others at MIT for the hub.
Author: PublicSessions
Session Name: SynonymousConstraintHub
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1748
1581062400 1748
Description: Various mutations of the gene TUBGCP6 lead to alterations in the amino acid sequence of the subsequent protein, which leads to potential loss-of-function of the protein. This presents pathologically with ubiquitous marked microcephaly, a receding forehead, diminutive anterior fontanelle, and sutural ridging, in addition to other varied symptoms such as cognitive impairment, reduced cranial circumference, and epilepsy.
Author: cadeemlet
Session Name: Juniata Bioinformatics CE & SA
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1262
1581062400 1262
Description: Juniata Bioinformatics SA and CE. Various mutations in gene TUBGCP6 result in microcephaly and chorioretinopathy. This gene codes for a protein that is part of the gamma tubulin complex, which is required for microtubule nucleation at the centrosome, and thus mitosis beginning with interphase. Mutations affecting this protein can lead to symptoms of a receding forehead, diminutive anterior fontanelle, sutural ridging, cognitive delay, visual impairment, diffuse pachygyria, and a hypoplastic cerebellar vermis. SA track: ENCODE Proteogenomics- this track is used to show functional elements of the human genome by using mass spectrometry to determine if translation is occurring by measuring protein produced by transcripts via proteogenomic mapping. This track identifies one exon within the TUBGCP6 gene. It is near the end of the mapped gene and its name is LGAGQTPGELLNPLVLNSVLSK. CE track: GTEx RNA-seq- Displayed also is track for GTEx Gene, which displays the relative gene expression through total mRNA counts of TUBGCP6 in 53 tissue sites distributed throughout the body. What can be derived primarily through this track is that the tissues which exhibit the greatest effects of TUBGCP6 gene mutations also exhibit the highest levels of genetic expression of the gene in healthy individuals, indicating a more prominent role in affected regions.
Author: slca1991
Session Name: Juniata Bioinformatics SA and CE
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1475
1581062400 1475
Description:
Author: prfreire
Session Name: MOLM13 MEIS1 pull down
Genome Assembly: hg19
Creation Date: 2019-09-11
Views: 922
1568188800 922
Description:
Author: ignaciogoyache
Session Name: dia5
Genome Assembly: hg38
Creation Date: 2020-02-14
Views: 1737
1581667200 1737
Description:
Author: Joseph
Session Name: ICH_rat
Genome Assembly: hg38
Creation Date: 2020-02-03
Views: 1459
1580716800 1459
Description:
Author: philip.tatman
Session Name: sacCer3RepTimingForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1496
1580457600 1496
Description:
Author: philip.tatman
Session Name: sacCer3CDKByPassForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1435
1580457600 1435
Description:
Author: dramirez
Session Name: NomLeu3PROseq1st
Genome Assembly: nomLeu3
Creation Date: 2020-04-22
Views: 1565
1587542400 1565
Description: The nucleosome sequencing data of mouse brain NAC cells from NCBI GEO archive accession GSE54263. The sequence alignment (mm9) coverage profiles (bigWig) of control, stress-susceptible and stress-resilient mice and the nucleosome occupancy change and shift events (BED) are shown.
Author: Erinija
Session Name: mouse NAC nucleosome events (mm9)
Genome Assembly: mm9
Creation Date: 2020-01-27
Views: 1804
1580112000 1804
Description:
Author: philip.tatman
Session Name: hg38NocReleaseForReview
Genome Assembly: hg38
Creation Date: 2020-01-31
Views: 1408
1580457600 1408
Description: The disease of interest is Infantile Parkinsonism found on the SLC6A3 gene as the variant IVS9+1G>T. Infantile Parkinsonism is described as is an extremely rare inherited neurological syndrome that presents in early infancy with hypo-kinetic Parkinsonism and dystonia that can lead to fatality. Parkinsonism is a condition that causes movement abnormalities seen in Parkinson's disease such as tremors, slow movement, and impaired speech or muscle stiffness due to he loss of dopamine-containing neurons. Dystonia is a movement disorder in which a person's muscles contract uncontrollably. The SCL6A3 gene provides instruction for making proteins, specifically a dopamine transporter. This protein is found in neurons and is responsible for the transport of dopamine into the cells. Dopamine is a chemical messenger that signals for motivation, behavior, and control movement. The variant changes the first nucleotide of the ninth intron from a G to a T. This mutation would result in a change of the splicing pattern of the DNA. The track that Nicci explored was the CRISPR Targets track which shows the DNA sequences targetable by CRISPR RNA guides using the enzyme Cas9 over the whole human genome. CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily alter DNA sequences and modify gene function. The track shows all potential -NGG target sites across the genome. Gray or black regions indicate impossible or hard to target areas. The colors blue, red, yellow, and green indicate the predicted chance of cleavage from unable to calculate to high predicted cleavage respectively. Mel explored the Vega Genes track which shows gene annotations from the Vertebrate Genome Annotation (Vega) database. Annotations are divided into two sub tracks from the Vega Human Genome Annotation project. The Two sub tracks include Vega protein coding and noncoding gene annotations as well as Vega annotated pseudogenes and immunoglobulin segments. This track follows the display conventions for gene prediction tracks. Transcript type may be found by clicking on the transcript identifier which forms the outside link to the Vega link detail page. School: Juniata College
Author: NMP94876
Session Name: Homewrok 3 Nicole Piccioni and Mell ended Juanita College Bioinformatics
Genome Assembly: hg19
Creation Date: 2020-02-29
Views: 1413
1582963200 1413
Description:
Author: keconne
Session Name: TAS2R38 group#5
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1294
1579593600 1294
Description:
Author: nguye5vx
Session Name: Spring 2020 TAS Test VN
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1378
1579593600 1378
Description:
Author: dschmelt
Session Name: Han_Chinese_LCT_Gene
Genome Assembly: hub_1969921_GCA_002180035.3_HG00514_prelim_3.0
Creation Date: 2020-01-20
Views: 1707
1579507200 1707
Description:
Author: keough
Session Name: monkey_guides
Genome Assembly: chlSab2
Creation Date: 2020-06-30
Views: 982
1593504000 982
Description:
Author: Maksimov_Denis
Session Name: ChromHMM_clusters
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 906
1620720000 906
Description:
Author: swttalyan
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-02-20
Views: 1456
1582185600 1456
Description:
Author: ilasa.5
Session Name: Day 3 group 5
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1528
1581494400 1528
Description:
Author: ManteoAndrade
Session Name: foxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1432
1581494400 1432
Description:
Author: keconne
Session Name: CGEMS yeast KEC test
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1453
1579075200 1453
Description:
Author: tmitchell
Session Name: Spring 2020 yeast test TM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1423
1579075200 1423
Description:
Author: marti4sm
Session Name: Fall19 Yeast test SM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1821
1579075200 1821
Description: This was an example of a CyVerse hosted assembly hub at the PAG 2020 workshop. The data at CyVerse is hosted at this directory that you can click and see the files: <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/">https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/</a>. In that directory you can click and read the text file named <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/hub.txt">hub.txt</a> and see how an assembly hub is a few stanzas that define the names of a genome and where to find binary-indexed raw data to display on the browser. The data is defined by the <code>twoBitPath araTha1.2bit</code> line in the genome stanza and in the <code>bigDataUrl cytoBandIdeo.bigBed</code> and <code>bigDataUrl ensGene.araTha1.bb</code> lines in the track stanzas. There is also an index file on the genes track <code>searchTrix ensGene.araTha1.ix</code> that allows to search the genes by both their names, such as <b> abcc2 </b>and their accessions, such as <b>AT3G50470.1</b>.
Author: brianlee
Session Name: CyVerse_Assembly_Hub
Genome Assembly: hub_1979095_araTha1
Creation Date: 2020-01-13
Views: 1419
1578902400 1419
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Bridgett vonHoldt from Princeton University. The title of Dr. vonHoldt's talk was <b>Everyone Is Your Friend! the Molecular Architecture of Hypersocial Canines</b>. Dr. vonHoldt analyzed wolf and dog populations and discovered a 5-Mb genomic region on chromosome 6 in dogs previously found to be under positive selection in domestic dog breeding. They gathered data on friendliness between a captive wolf and pet dog populations and then examined variants. The region affected by structural variants associated with the exuberant sociability of domestic dogs related to a gene WBSCR17 on chr7 in humans linked to Williams-Beuren syndrome (WBS), a multisystem congenital disorder characterized by hypersocial behavior. Humans with this mutation have a lack of stranger danger and are overly cheerful. This session shows the WBSCR17 gene in human.
Author: brianlee
Session Name: Human_WBSCR17
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1492
1578902400 1492
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Claudio V. Mello from Oregon Health and Science University. Dr. Mello's talk was titled <b>What Comparative Studies of Parrot Genomes Can Teach Us about Longevity, Large Brains and Cognition</b>. Dr. Mello identified genomic features under selection in parrots and other long-lived birds that included telomerase activity (TERT), DNA damage repair, control of cell proliferation, cancer, immunity, and anti-oxidative mechanisms. His group also identified many brain-expressed, parrot-specific paralogs with known functions in neural development or vocal-learning brain circuits seen in humans (AUS2). This session shows similar alignment information in the conservation track around human AUTS2 as in one of Dr. Mello’s supplemental slides.
Author: brianlee
Session Name: Human_AUTS2
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1679
1578902400 1679
Description: This session reflects a PAG 2020 Poster by Hao Meng et al. from Peking-Tsinghua Center for Life Sciences, Peking University. The title of the poster was <b>Morphology and Genetics of Kinked Tails of Domestic Cats (Felis catus) in East and Southeast Asia</b>. Hao Meng and colleagues investigated the morphology and genetics of kinked tails in cats. Mutations in coding sequences (CDS) of T and HES7 were identified correlated to the short tails in Manx and Japanese bobtail breeds as well as some feral cats in Asia, However, about one third of short-tailed cats in China do not carry either variant. The poster described a new 1.6 Mb region with non-synonymous mutations were seen, suggesting changes in regulatory regions, the poster concluded. An example of viewing this region on the UCSC Browser with the regulatory Gene Interactions track turned on. In humans the interactions track seem to suggest this region has many long distant interactions spanning across it from distant enhancers.
Author: brianlee
Session Name: Human_HES7
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1504
1578902400 1504
Description: This session reflects a PAG 2020 Saturday Session, Cattle/Sheep/Goat 1, and the speaker George E. Liu from the Animal Genomics and Improvement Laboratory, USDA-ARS. The session title was <b>Comparative Epigenomics and Genotype-Phenotype Association Analyses Revealed Conserved Genetic Architecture underlying Complex Traits between Cattle and Human</b>. Dr. Liu’s lab examined comparative genomics around the histone marks and found that they could transfer cell-type-specific information from the human data to infer similar issues about genes related to certain diseases. A specific example was PIK3CG, a gene high specifically expressed in mononuclear cells was significantly associated with both age-at-menopause in human and daugter-still-birth in cattle. This session shows PIK3CG in human.
Author: brianlee
Session Name: Human_PIK3CG
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1553
1578902400 1553
Description:
Author: ManteoAndrade
Session Name: mi ventana
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1788
1581408000 1788
Description:
Author: nguye5vx
Session Name: Fall19 Yeast Test VN
Genome Assembly: sacCer3
Creation Date: 2020-01-19
Views: 1574
1579420800 1574
Description:
Author: agacita
Session Name: enhancer_dominic
Genome Assembly: hg19
Creation Date: 2020-01-03
Views: 1502
1578038400 1502
Description:
Author: saadiak2
Session Name: MS
Genome Assembly: mm9
Creation Date: 2019-12-19
Views: 1542
1576742400 1542
Description:
Author: celiagonzalez98
Session Name: class 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1710
1581408000 1710
Description:
Author: mecay.1
Session Name: session 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1720
1581408000 1720
Description: ATAC-seq of exocrine epithelial stem cells
Author: woaichixiangcai
Session Name: Exocrine_ATAC
Genome Assembly: mm10
Creation Date: 2024-06-29
Views: 102
1719648000 102
Description:
Author: katerynamarku
Session Name: TAS2R38
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 632
1643702400 632
Description:
Author: JonMatas
Session Name: Geno3 G4
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1813
1581494400 1813
Description:
Author: egrossi
Session Name: Hi-C BAF47
Genome Assembly: hg18
Creation Date: 2019-11-29
Views: 1682
1575014400 1682
Description: In this specific session of 3 bases with scores missing, at the very end of chrM of mm10, you can see data is lacking from all the related sources (yellow highlight): http://genome.ucsc.edu/s/brianlee/mm10_chrM This explains how there can be a discrepancy between the number of positions covered by the phastCons file and the length of a chromosome. It is likely caused by gaps in the multiple alignment process. Gaps often result from gaps in the reference assembly or variable regions that do not align well between species. Anywhere the multiple alignment is lacking data, phastCons cannot be used to calculated conservation scores.
Author: brianlee
Session Name: mm10_chrM
Genome Assembly: mm10
Creation Date: 2019-11-22
Views: 1928
1574409600 1928
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1383
1581321600 1383
Description:
Author: tacazares
Session Name: maxATAC ATAC-seq Data
Genome Assembly: hg38
Creation Date: 2022-04-11
Views: 615
1649664000 615
Description:
Author: Erinija
Session Name: NA12878 WES Benchmark
Genome Assembly: hg19
Creation Date: 2019-11-28
Views: 2353
1574928000 2353
Description:
Author: mia_21
Session Name: mitochonrial cyb mutation
Genome Assembly: hg38
Creation Date: 2019-10-31
Views: 1512
1572508800 1512
Description:
Author: Brigitte
Session Name: snp hla vph
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1478
1571904000 1478
Description:
Author: cocopow
Session Name: hg38_genes24336
Genome Assembly: hg38
Creation Date: 2019-10-23
Views: 2090
1571817600 2090
Description:
Author: cocopow
Session Name: hg19_LINC00299
Genome Assembly: hg19
Creation Date: 2019-10-25
Views: 1533
1571990400 1533
Description:
Author: sguc
Session Name: miR-122_KO_genotyping_primers
Genome Assembly: mm10
Creation Date: 2019-10-17
Views: 1572
1571299200 1572
Description:
Author: ani_davis
Session Name: TAS2R38 group6
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 623
1643702400 623
Description:
Author: zhangh357
Session Name: hg19_m6A_site
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1683
1571040000 1683
Description:
Author: cocopow
Session Name: dm6_transcripts
Genome Assembly: dm6
Creation Date: 2019-10-09
Views: 1532
1570608000 1532
Description:
Author: ykumar84
Session Name: mm10_CRE
Genome Assembly: mm10
Creation Date: 2019-10-07
Views: 1583
1570435200 1583
Description:
Author: ykumar84
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 1778
1570176000 1778
Description:
Author: mecay.1
Session Name: session 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1674
1581321600 1674
Description:
Author: cocopow
Session Name: hg38_ENCreg
Genome Assembly: hg38
Creation Date: 2019-10-03
Views: 1532
1570089600 1532
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241C
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1883
1570003200 1883
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241B
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1712
1570003200 1712
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241A
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1641
1570003200 1641
Description:
Author: sallen
Session Name: DSP-hg38
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1467
1581408000 1467
Description:
Author: rgmilian
Session Name: hg19_BamHIsite
Genome Assembly: hg19
Creation Date: 2019-09-25
Views: 739
1569398400 739
Description:
Author: rgmilian
Session Name: hg19_20p13_exon_view_flaggedSNPs+exons
Genome Assembly: hg19
Creation Date: 2019-09-24
Views: 603
1569312000 603
Description:
Author: barloweml
Session Name: YeastPracticeMLB
Genome Assembly: sacCer3
Creation Date: 2019-09-24
Views: 1581
1569312000 1581
Description:
Author: ykumar84
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-09-18
Views: 1930
1568793600 1930
Description:
Author: IsaacGelman
Session Name: mm10_h3k4me3
Genome Assembly: mm10
Creation Date: 2019-11-01
Views: 1473
1572595200 1473
Description:
Author: nheyer
Session Name: New_wiggles
Genome Assembly: hg38
Creation Date: 2019-11-12
Views: 1446
1573545600 1446
Description: CircRNA annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: hg38 circRNA annotation
Genome Assembly: hg38
Creation Date: 2019-02-10
Views: 1319
1549785600 1319
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rn5 circRNA annotation
Genome Assembly: rn5
Creation Date: 2016-09-23
Views: 1405
1474617600 1405
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: mm10 circRNA annotation
Genome Assembly: mm10
Creation Date: 2016-09-23
Views: 1320
1474617600 1320
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: monDom5 circRNA annotation
Genome Assembly: monDom5
Creation Date: 2016-09-23
Views: 1392
1474617600 1392
Description:
Author: MarcoDS
Session Name: B_to_PSC_reprogramming
Genome Assembly: mm10
Creation Date: 2019-09-16
Views: 1492
1568620800 1492
Description:
Author: bethpay
Session Name: mm10_il7r_findenhancerpromoter
Genome Assembly: mm10
Creation Date: 2019-09-09
Views: 1643
1568016000 1643
Description:
Author: [email protected]
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-09-09
Views: 1362
1568016000 1362
Screenshot not available
Click Here to view
Description:
Author: tolvayha
Session Name: Fall18 Worm test HT
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1652
1535616000 1652
Screenshot not available
Click Here to view
Description:
Author: tolvayha
Session Name: RHO - Photoreceptor
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1593
1542096000 1593
Description:
Author: swarnaseetha
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-10-23
Views: 1464
1571817600 1464
Description: ReMap 2018: An atlas of regulatory regions from an integrative analysis of Human DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info. <a href="https://academic.oup.com/nar/article/46/D1/D267/4602873">ReMap 2018 paper</a>.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2018
Genome Assembly: hg38
Creation Date: 2017-08-11
Views: 3210
1502438400 3210
Description:
Author: rasou2ba
Session Name: hg19 - rs12357257 - Rasoul
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 1817
1509436800 1817
Description:
Author: pesinojv
Session Name: TAS2R38 group#4
Genome Assembly: hg19
Creation Date: 2018-01-22
Views: 1681
1516608000 1681
Description:
Author: oshgo
Session Name: 14q32Methyl450-GO8
Genome Assembly: hg19
Creation Date: 2015-10-19
Views: 1953
1445241600 1953
Description: GH01J209814 is an enhancer associated with the gene IRF6 (Interferon Regulatory Factor 6). Coding mutations in IRF6 are known to be pathogenic, causing diseases related to cleft lip and cleft palate, such as Van Der Woude Syndrome 1 (VWS1). GH01J209814, an enhancer of IRF6 located ~10kb upstream from the gene, harbors regulatory non-coding variants strongly associated with VWS1.
Author: simonf
Session Name: IRF6 cleft lip enhancer
Genome Assembly: hg19
Creation Date: 2018-11-28
Views: 1690
1543392000 1690
Description:
Author: australia2018
Session Name: hg18_EP_bamSnps_custom
Genome Assembly: hg18
Creation Date: 2018-11-07
Views: 1666
1541577600 1666
Description:
Author: [email protected]
Session Name: BAC and FOSMID
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1634
1553673600 1634
Description:
Author: jazmynperez
Session Name: APP
Genome Assembly: hg19
Creation Date: 2018-11-07
Views: 2307
1541577600 2307
Description:
Author: huijing
Session Name: check_pacbio
Genome Assembly: dm6
Creation Date: 2018-11-06
Views: 864
1541491200 864
Description:
Author: cehnouz
Session Name: test1
Genome Assembly: hg19
Creation Date: 2017-08-25
Views: 1792
1503648000 1792
Description:
Author: jtm
Session Name: shiny_app_hg38_v2
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 2849
1541404800 2849
Description:
Author: ruhollah
Session Name: 18_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1777
1541059200 1777
Description:
Author: ruhollah
Session Name: 20_chr1
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1678
1541059200 1678
Description:
Author: ruhollah
Session Name: 14_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1872
1541059200 1872
Description:
Author: ruhollah
Session Name: 17_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1698
1541059200 1698
Description:
Author: ruhollah
Session Name: 19_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1636
1541059200 1636
Description:
Author: ruhollah
Session Name: 16_chr5
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1641
1541059200 1641
Description:
Author: ruhollah
Session Name: 6_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1636
1541059200 1636
Description:
Author: ruhollah
Session Name: 8_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1967
1541059200 1967
Description:
Author: ruhollah
Session Name: 11_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1624
1541059200 1624
Description:
Author: ruhollah
Session Name: 12_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1919
1541059200 1919
Description:
Author: ruhollah
Session Name: 13_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1656
1541059200 1656
Description:
Author: ruhollah
Session Name: 15_chr19
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1589
1541059200 1589
Description:
Author: ruhollah
Session Name: 7_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1939
1541059200 1939
Description:
Author: ruhollah
Session Name: 9_chr20
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1615
1541059200 1615
Description:
Author: ruhollah
Session Name: 5_chr16
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1713
1541059200 1713
Description:
Author: ruhollah
Session Name: 4_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1622
1541059200 1622
Description:
Author: ruhollah
Session Name: 10_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1635
1541059200 1635
Description:
Author: ruhollah
Session Name: 3_chr14
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1613
1541059200 1613
Description:
Author: ruhollah
Session Name: 2_chr8
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1754
1541059200 1754
Description:
Author: ruhollah
Session Name: 1_chr15
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1581
1541059200 1581
Description: This session highlights data from the DASHR v2.0 Hub, created by the Wang lab at the University of Pennsylvania. DASHR is a comprehensive database of expression and processing information to date on all major classes of human small non-coding RNA (sncRNA) genes and mature sncNA annotations, expression levels, sequence and RNA processing information across 185 human tissues, cell types, and cell lines. The region being visualized shows mir-132. A sncRNA linked to post-transcriptional regulation of neuronal cells. More info on DASHR V2.0: http://dashr2.lisanwanglab.org/
Author: Lou
Session Name: DASHRV2
Genome Assembly: hg38
Creation Date: 2018-12-11
Views: 1912
1544515200 1912
Description:
Author: sharma.896
Session Name: TP53
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1875
1540886400 1875
Description: human p53 ChIP-seq coverage depth (tracks) & SISSRs peak calls with associated differential gene expression from published data as of May 2015
Author: cocapo
Session Name: human p53 Binding And Expression Resource (BAER) hub
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1954
1540886400 1954
Description:
Author: cocopow
Session Name: hg19_rn6_geneHancer
Genome Assembly: hg19
Creation Date: 2019-01-18
Views: 1767
1547798400 1767
Description:
Author: cocopow
Session Name: hg38_GeneHancer
Genome Assembly: hg38
Creation Date: 2019-01-28
Views: 1662
1548662400 1662
Description:
Author: apacis
Session Name: Wu_ARMC5_ChIP_C3G
Genome Assembly: mm10
Creation Date: 2020-10-08
Views: 1027
1602144000 1027
Description: This sessionView is a collection of tracks centered around large genetic variants (CNVs). The session is organized with gene annotations at the top, followed by the <a href="https://academic.oup.com/nar/article/42/D1/D986/1068860" target="_blank">DGV Struct Var track</a>, which displays variants observed in healthy individuals. The rest of the tracks include different databases that visualize large variants linked to disease phenotypes. The region displayed is a 2Mbp region on chr4 with many pathological variants present.
Author: view
Session Name: VariationCNVs
Genome Assembly: hg19
Creation Date: 2018-10-16
Views: 1788
1539676800 1788
Description: This sessionView is a collection of tracks centered around genetic variation. The collection of tracks primarily displays small variants from multiple databases. The session is organized with tracks having fewer variants with more annotations near the top, and large tracks with fewer annotations near the bottom. The region displayed is the <a href="https://ghr.nlm.nih.gov/gene/SOD1" target="_blank">SOD1 gene</a> which is well annotated and provides an exemplar for this track collection.
Author: view
Session Name: Variation
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1671
1539158400 1671
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is an ultra-conserved region in the PCBP2 gene where little divergence is seen throughout all mammals. A similar session is available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationDiv" target="_blank">ConservationDiv</a>, which looks at a highly divergent region of the genome.
Author: view
Session Name: ConservationCons
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2610
1539158400 2610
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is a <a href="https://www.hhmi.org/news/researchers-identify-human-dna-fast-track" target="_blank">human accelerated region (HAR)</a>. HARs are among the most divergent regions in the genome displaying high divergence even among primates. An alternate region of this session is also available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationCons" target="_blank">ConservationCons</a>, which looks at a highly conserved region of the genome.
Author: view
Session Name: ConservationDiv
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2574
1539158400 2574
Description: This sessionView is a collection of tracks centered around clinical significance. The track composition is similar to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> public session, however, the number of tracks has been reduced to increase clarity. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. The large region, which also includes part of the adjacent GRK4 gene, showcases the more concise view of this track in contrast to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> session. A similar session is also available which shows the bp resolution CAG repeat linked to Huntington's disease, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a>.
Author: view
Session Name: ClinicalLite
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2917
1539158400 2917
Description: This sessionView is a collection of tracks centered around gene support. The region displayed includes the <a href="https://www.ncbi.nlm.nih.gov/gene /3198" target="_blank"> HOXA1</a> gene and its upstream neighbor <a href="https://www.ncbi.nlm.nih.gov/gene/100506311" target="_blank"> HOTAIRM1</a>. The view is organized with different gene annotation approaches at the top, followed by mRNA evidence, and TSS data at the bottom.
Author: view
Session Name: GeneSupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 2902
1538726400 2902
Description:
Author: xingjie
Session Name: FMR1-AFF2-iPSC screening
Genome Assembly: hg38
Creation Date: 2018-10-05
Views: 1826
1538726400 1826
Description:
Author: EsterCastillo
Session Name: VanesaGarcia_AS
Genome Assembly: hg38
Creation Date: 2018-08-14
Views: 1933
1534233600 1933
Description:
Author: EsterCastillo
Session Name: SandraHernandez_UPF
Genome Assembly: hg38
Creation Date: 2018-12-10
Views: 1554
1544428800 1554
Description:
Author: EsterCastillo
Session Name: NuriaSala_ICO_AS
Genome Assembly: hg19
Creation Date: 2018-06-18
Views: 1635
1529308800 1635
Description:
Author: EsterCastillo
Session Name: NRCC_HospTxagorritxo_Guiomar
Genome Assembly: hg19
Creation Date: 2018-08-01
Views: 1660
1533110400 1660
Description:
Author: EsterCastillo
Session Name: Meme_ROIs_AmpliSeq
Genome Assembly: hg19
Creation Date: 2018-12-18
Views: 1569
1545120000 1569
Description:
Author: EsterCastillo
Session Name: MarcSorigue
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 2002
1535097600 2002
Description:
Author: EsterCastillo
Session Name: LifeSequencing_JuanMartinez
Genome Assembly: hg19
Creation Date: 2018-05-18
Views: 1616
1526630400 1616
Description:
Author: EsterCastillo
Session Name: LauraMuinelo_CHUS_AS
Genome Assembly: hg38
Creation Date: 2018-05-31
Views: 1788
1527753600 1788
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_25bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 2261
1553414400 2261
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_10bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 1509
1553414400 1509
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos_NMs
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1590
1536220800 1590
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 1563
1535097600 1563
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Tcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1461
1559030400 1461
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Bcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1451
1559030400 1451
Description:
Author: EsterCastillo
Session Name: BarbaraTazon_AS_Myeloid
Genome Assembly: hg19
Creation Date: 2018-04-09
Views: 1673
1523260800 1673
Description:
Author: EsterCastillo
Session Name: Arnau_DrViladell_AmpliSeq
Genome Assembly: hg19
Creation Date: 2019-05-08
Views: 1414
1557302400 1414
Description:
Author: EsterCastillo
Session Name: AnaSebio_HospStPau
Genome Assembly: hg19
Creation Date: 2018-05-01
Views: 1806
1525161600 1806
Description:
Author: EsterCastillo
Session Name: AnaOsorio_AS_CNIO
Genome Assembly: hg19
Creation Date: 2018-05-24
Views: 1679
1527148800 1679
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge2
Genome Assembly: hg19
Creation Date: 2019-02-11
Views: 1541
1549872000 1541
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge
Genome Assembly: hg19
Creation Date: 2019-01-31
Views: 1634
1548921600 1634
Description:
Author: EsterCastillo
Session Name: AmpliSeq Focus
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1588
1534752000 1588
Description:
Author: EsterCastillo
Session Name: AmpliSeq Cancer HotSpots v2
Genome Assembly: hg19
Creation Date: 2018-06-06
Views: 1562
1528272000 1562
Description:
Author: EsterCastillo
Session Name: 12Oct_todos37g_DLW
Genome Assembly: hg19
Creation Date: 2019-01-20
Views: 1925
1547971200 1925
Description:
Author: tzaro
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-10-08
Views: 1898
1538985600 1898
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq EGFR shjun
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1465
1547625600 1465
Description:
Author: sajjeev
Session Name: sj39_40
Genome Assembly: hg19
Creation Date: 2019-01-17
Views: 2174
1547712000 2174
Description:
Author: cocopow
Session Name: mm10_limbs
Genome Assembly: mm10
Creation Date: 2019-01-15
Views: 1773
1547539200 1773
Description:
Author: emmawentworth
Session Name: Adult-Mouse-Adipose
Genome Assembly: mm10
Creation Date: 2019-04-29
Views: 1568
1556524800 1568
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 2
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1634
1538467200 1634
Description:
Author: brittatj
Session Name: Fall19 Yeast test(TB)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1403
1566892800 1403
Description:
Author: Matteo
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-10-02
Views: 1572
1538467200 1572
Description:
Author: cocapo
Session Name: dense2pack
Genome Assembly: hg38
Creation Date: 2018-09-26
Views: 1724
1537948800 1724
Description:
Author: akhoke
Session Name: KMT2E/SRPK2_2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1757
1537862400 1757
Description:
Author: mazawm
Session Name: hg19#19SingleNucleotideResolution
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1391
1537862400 1391
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 2 (SNPs)
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1692
1537862400 1692
Description:
Author: anglemem
Session Name: AMD SNP 2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1711
1537862400 1711
Description:
Author: akhoke
Session Name: KMT2E/SRPK2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1687
1537862400 1687
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 1
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1712
1537862400 1712
Description:
Author: mazawm
Session Name: hg19#19GenomicContext
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1456
1537862400 1456
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 zoom
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1534
1537862400 1534
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1587
1537862400 1587
Description:
Author: Heywhoyou22
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1605
1537862400 1605
Description:
Author: mazawm
Session Name: hg19HGDmazawm2
Genome Assembly: hg19
Creation Date: 2018-09-19
Views: 1589
1537344000 1589
Description:
Author: akhoke
Session Name: HGD2
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1594
1537257600 1594
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise, Exon 10
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1572
1537257600 1572
Description:
Author: white4cj
Session Name: Fall 19 Yeast Test (JW, PA, MG)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1457
1566892800 1457
Description:
Author: akhoke
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1595
1537257600 1595
Description:
Author: mazawm
Session Name: hg19HGDmazawm
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1614
1537257600 1614
Description:
Author: anglemem
Session Name: HGD Gene (EMA)
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1654
1537257600 1654
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1554
1537257600 1554
Description:
Author: yangyangyh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-16
Views: 1596
1537084800 1596
Description: The LCT gene, responsible for digesting lactose, and the nearby MCM6 gene, which harbors variants that affect the expression of LCT. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCTandMCM6
Genome Assembly: hg19
Creation Date: 2022-06-22
Views: 589
1655884800 589
Description:
Author: dcaetan2
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-12-05
Views: 1920
1512460800 1920
Description:
Author: cocopow
Session Name: hg19_chrM
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 2157
1565683200 2157
Description:
Author: ruifang
Session Name: TAC3
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 1470
1565510400 1470
Description:
Author: cocopow
Session Name: panTro6_refSeq
Genome Assembly: panTro6
Creation Date: 2019-08-20
Views: 1453
1566288000 1453
Description:
Author: Alexandra Despang
Session Name: PWD_SNPS_mm10
Genome Assembly: mm10
Creation Date: 2016-01-15
Views: 1433
1452844800 1433
Description:
Author: mziegler
Session Name: encode_Accessibility _4
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1721
1536220800 1721
Description:
Author: mziegler
Session Name: encode_Accessibility _3
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1724
1536220800 1724
Description:
Author: mziegler
Session Name: encode_Accessibility _2
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1720
1536220800 1720
Description:
Author: mazawm
Session Name: hg19withDSPandMYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1615
1536048000 1615
Description:
Author: akhoke
Session Name: hg19_9/4/18
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1620
1536048000 1620
Description:
Author: Heywhoyou22
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1702
1536048000 1702
Description:
Author: Heywhoyou22
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1600
1536048000 1600
Description:
Author: zheyangshan
Session Name: hg19 BCL2
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1505
1536048000 1505
Description:
Author: abby.stapleton
Session Name: Spring17 Mouse Test
Genome Assembly: mm9
Creation Date: 2019-07-29
Views: 1549
1564387200 1549
Description:
Author: abby.stapleton
Session Name: Spring17 Human Test
Genome Assembly: hg38
Creation Date: 2019-07-29
Views: 1401
1564387200 1401
Description:
Author: abby.stapleton
Session Name: Spring17 Worm Test
Genome Assembly: ce11
Creation Date: 2019-07-29
Views: 1389
1564387200 1389
Description:
Author: abby.stapleton
Session Name: Spring17 Yeast Test
Genome Assembly: sacCer3
Creation Date: 2019-07-29
Views: 1417
1564387200 1417
Description:
Author: jwjiao
Session Name: PRDM16KO1_E15WT1.anno
Genome Assembly: hg38
Creation Date: 2019-08-05
Views: 1385
1564992000 1385
Description:
Author: xgwZRyfWLidWxULv
Session Name: RPE_public
Genome Assembly: hg19
Creation Date: 2019-01-15
Views: 1469
1547539200 1469
Description:
Author: elencampoy
Session Name: HsInv0379
Genome Assembly: hg19
Creation Date: 2021-02-25
Views: 909
1614240000 909
Description:
Author: bondurlc
Session Name: TAS2R38 group 3
Genome Assembly: hg19
Creation Date: 2018-09-03
Views: 1605
1535961600 1605
Description:
Author: ruhollah
Session Name: hg19_118Chr22_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1561
1547452800 1561
Description:
Author: ruhollah
Session Name: hg19_100Chr19_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1528
1547452800 1528
Description:
Author: mazawm
Session Name: mazawm/hg19
Genome Assembly: hg19
Creation Date: 2018-08-31
Views: 1597
1535702400 1597
Description:
Author: erhuoyi
Session Name: suva
Genome Assembly: hg38
Creation Date: 2018-08-31
Views: 1665
1535702400 1665
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) Assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 2018
1535616000 2018
Description:
Author: akhoke
Session Name: Human Genome DSP
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1584
1535616000 1584
Description:
Author: anglemem
Session Name: EmilyAnglemyer 8/30 In class browser assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1606
1535616000 1606
Description:
Author: Morgan_T
Session Name: Aug30 Asignment MT
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1603
1535616000 1603
Description:
Author: stjacqrm
Session Name: Spring18_DSP_RMSJ
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1704
1535616000 1704
Description:
Author: benbeijs
Session Name: CGEMS Worm (JSB) Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1672
1535616000 1672
Description:
Author: sschuma
Session Name: Fall18 DSP (SS)
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1569
1535616000 1569
Description:
Author: akhoke
Session Name: Yeast AKH
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1825
1535616000 1825
Description:
Author: erick.gabriel
Session Name: ICD-1 gene (by Erick)
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1678
1535616000 1678
Description:
Author: mazawm
Session Name: mazawm8/30
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1721
1535616000 1721
Description:
Author: akhoke
Session Name: CGEMS yeast AKH test
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1634
1535616000 1634
Description:
Author: Morgan_T
Session Name: Fall18 Yeast test M.T.
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1595
1535616000 1595
Description:
Author: foxaa
Session Name: Fall18 Worm test AF
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 2148
1535616000 2148
Description:
Author: Heywhoyou22
Session Name: Spring18 Worm test MRK
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1592
1535616000 1592
Description:
Author: stjacqrm
Session Name: Spring18_Yeast_test_RMSJ
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1788
1535616000 1788
Description:
Author: hammer
Session Name: piranha-eclip_sclip2
Genome Assembly: hg38
Creation Date: 2018-08-30
Views: 1690
1535616000 1690
Description:
Author: sschuma
Session Name: Fall18 Yeast Test (SS)
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1581
1535616000 1581
Description:
Author: Heywhoyou22
Session Name: forenke2
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1646
1543478400 1646
Description:
Author: Heywhoyou22
Session Name: forenke
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1573
1543478400 1573
Description:
Author: Boonede
Session Name: TAS2R38#6
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1454
1547452800 1454
Description: RYiu-90010430-MEDG580-UBC-2020
Author: cpddoraemon
Session Name: RYiu-90010430-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2022-10-09
Views: 467
1665302400 467
Description:
Author: anzelm
Session Name: hg19-hrc3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 1825
1521446400 1825
Description:
Author: anzelm
Session Name: hg19-180-10-3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 1631
1521446400 1631
Description:
Author: anglemem
Session Name: MYBPC1 Anglemyer
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1586
1536048000 1586
Description:
Author: anglemem
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 1901
1536134400 1901
Description:
Author: anglemem
Session Name: 10/2 custom track assignment
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1812
1538467200 1812
Description:
Author: allisontaggart
Session Name: hg19_BPs
Genome Assembly: hg19
Creation Date: 2017-01-18
Views: 2046
1484726400 2046
Description:
Author: alexc
Session Name: CytoSettings
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 1870
1520928000 1870
Description:
Author: alexaabdelaziz
Session Name: colored_clusters_Alexa_AA
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 1896
1487923200 1896
Description:
Author: akhoke
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1617
1536048000 1617
Description:
Author: akhoke
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1634
1536048000 1634
Description:
Author: akhoke
Session Name: CRLs3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1597
1542096000 1597
Description:
Author: akhoke
Session Name: CRLs2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1581
1542096000 1581
Description:
Author: akhoke
Session Name: CRLs
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1580
1542096000 1580
Description:
Author: akhoke
Session Name: AMD SNP Custom Track
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1618
1538553600 1618
Description:
Author: airibarren.1
Session Name: Ventana buena + Hubs
Genome Assembly: hg38
Creation Date: 2018-02-06
Views: 1577
1517904000 1577
Description:
Author: airibarren.1
Session Name: Regulatory elements; epigentic marks
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2080
1519632000 2080
Description:
Author: airibarren.1
Session Name: Oregano
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1739
1519632000 1739
Description:
Author: airibarren.1
Session Name: NHLF
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1720
1519632000 1720
Description:
Author: airibarren.1
Session Name: NHEK
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1694
1519632000 1694
Description:
Author: airibarren.1
Session Name: K562
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1800
1519632000 1800
Description:
Author: airibarren.1
Session Name: HUVEC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2050
1519632000 2050
Description:
Author: airibarren.1
Session Name: HSMM
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1834
1519632000 1834
Description:
Author: airibarren.1
Session Name: H1-hESC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1946
1519632000 1946
Description:
Author: airibarren.1
Session Name: Genes and gene expression
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1740
1519632000 1740
Description:
Author: airibarren.1
Session Name: GM12878
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1728
1519632000 1728
Description:
Author: airibarren.1
Session Name: Evolution
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1870
1519632000 1870
Description:
Author: airibarren.1
Session Name: Ensembl segment
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1707
1519632000 1707
Description:
Author: airibarren.1
Session Name: Ensembl activity
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1724
1519632000 1724
Description:
Author: airibarren.1
Session Name: ChIp
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1732
1519632000 1732
Description:
Author: agacita
Session Name: Regulatory_Variants_Heart_333
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 1784
1526025600 1784
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_labels
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 2119
1525939200 2119
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_Final
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 1778
1526025600 1778
Description:
Author: agacita
Session Name: Regulatory_Var_89912022
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 1572
1525939200 1572
Description:
Author: afanas
Session Name: hg19-H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-11-27
Views: 2056
1511769600 2056
Description:
Author: gerbermm
Session Name: TAS2R38 Grp6 MG
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1857
1547452800 1857
Description:
Author: hammer
Session Name: piranha-eclip_sclip
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1639
1535356800 1639
Description:
Author: hkao
Session Name: SMARCC1 4-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1432
1562659200 1432
Description:
Author: hammer
Session Name: ablife
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1720
1535356800 1720
Description: RNA-seq in cell lines were carried out as follows: after MGC803 cells were transfected with siRNA against circMRPS35 or corresponding control in triplicate, total RNA were extracted and cDNA libraries were constructed for rRNA-depleted sample using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina according to the manufacturer’s instructions, and were sequenced on Illumina HiSeq Xten. RPKM method was used to determine the gene expression. The raw data were analyzed according to the DESeq2 method. Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. For gene ontology (GO) analysis, we downloaded the GO annotations from NCBI, UniProt and the Gene Ontology. Fisher’s exact test was applied to identify the significant GO categories and FDR was used to correct the p-values.
Author: jieMM
Session Name: hg38_FINAL
Genome Assembly: hg38
Creation Date: 2019-11-05
Views: 1705
1572940800 1705
Description:
Author: leonic
Session Name: bing li et al. m6A RIP
Genome Assembly: mm10
Creation Date: 2018-08-21
Views: 1711
1534838400 1711
Description:
Author: zxtzhangqian
Session Name: 3a-140-IDH
Genome Assembly: mm9
Creation Date: 2018-08-20
Views: 1827
1534752000 1827
Description:
Author: davis2018
Session Name: hg19_example_asl
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1594
1534752000 1594
Description:
Author: ruhollah
Session Name: hg19_29ChrX_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1675
1543219200 1675
Description:
Author: ruhollah
Session Name: hg19_13Chr3_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1519
1543219200 1519
Description: This session shows how the multi-region tool allows you to swap in alternate sequences into the main sequence, when desired. For example, if you click the "mutli-region" button under the Browser image (or go to the top "View" menu and then select it), you can paste chr5_KI270794v1_alt in the "Show one alternate haplotype, placed on its chromosome, using ID:" box and then also click the " Highlight alternating regions in multi-region view" box and the result is this session.<br> <br> This issue came up when a user was doing PCR and found two results, one on chr5 and one on chr5_KI270794v1_alt and wanted to understand the meaning of the chr5_..._alt PCR hit. On our gateway page for hg38 (http://genome.ucsc.edu/cgi-bin/hgGateway?db=hg38) you will find an Assembly Details section, which will explain how the Genome Reference Consortium (GRC) in building a reference assembly observed several human chromosomal regions exhibit sufficient variability to prevent adequate representation by a single sequence and to address this issue, the GRCh38/hg38 assembly provides alternate sequence for selected variant regions through the inclusion of alternate loci scaffolds (or alt loci). The assembly contains 261 alt loci, where this chr5_KI270794v1_alt is one of the regions that just happens to be right around the specific gene of interest. This GRC Assembly Terminology page is useful in learning the definition of alternate sequences: https://www.ncbi.nlm.nih.gov/grc/help/definitions/ The answer to the user was that in some ways one can interpret this additional chr5_KI270794v1_alt PCR result as a representation where the GRC determined an additional sequence provides an alternate representation of the same locus. And this session helps to visualize that alternate sequence in place around the rest of the chromosome. <img src="https://groups.google.com/a/soe.ucsc.edu/group/genome/attach/d6cb8d335b5b/image.png?part=0.1&authuser=0" alt="PCR results">
Author: brianlee
Session Name: hg38_ chr5_KI270794v1_alt
Genome Assembly: hg38
Creation Date: 2018-08-10
Views: 1631
1533888000 1631
Description:
Author: chubukovp
Session Name: hg19_SMC_upload
Genome Assembly: hg19
Creation Date: 2016-10-14
Views: 1980
1476432000 1980
Description:
Author: anglemem
Session Name: CGEMS Worm EA Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1558
1535616000 1558
Description:
Author: ruhollah
Session Name: hg19_170Chr1_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1501
1547452800 1501
Description:
Author: ruhollah
Session Name: hg19_173Chr2_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1506
1547452800 1506
Description: RNA-seq data from Lee HC et al. Open Biol. 2020 Feb. Molecular anatomy of the pre-primitive-streak chick embryo.
Author: stern_lab
Session Name: Lee HC et al. chick pre-primitive streak
Genome Assembly: galGal5
Creation Date: 2020-06-25
Views: 1418
1593072000 1418
Description:
Author: cocopow
Session Name: hg38_bw_GSM1131536
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1479
1551945600 1479
Description:
Author: cocopow
Session Name: hg38_HGMDvsCurated
Genome Assembly: hg38
Creation Date: 2019-03-06
Views: 1711
1551859200 1711
Description:
Author: cocopow
Session Name: danRer11_bw_GSM1131536
Genome Assembly: danRer11
Creation Date: 2019-03-07
Views: 1389
1551945600 1389
Description:
Author: cocopow
Session Name: mm10_bejTB
Genome Assembly: mm10
Creation Date: 2019-08-01
Views: 1357
1564646400 1357
Description:
Author: ascendgene
Session Name: 60genes panel chrX
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1603
1532505600 1603
Description:
Author: ascendgene
Session Name: 60genes panel chr22
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1615
1532505600 1615
Description:
Author: ascendgene
Session Name: 60genes panel chr17
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1679
1532505600 1679
Description:
Author: ascendgene
Session Name: 60genes panel chr16
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1577
1532505600 1577
Description:
Author: ascendgene
Session Name: 60genes panel chr14
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1577
1532505600 1577
Description:
Author: Gabriel
Session Name: LDTF-Kras
Genome Assembly: mm10
Creation Date: 2020-03-26
Views: 1327
1585209600 1327
Description:
Author: ascendgene
Session Name: 60genes panel chr18
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1493
1532505600 1493
Description:
Author: dorothyzhao
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 1382
1565683200 1382
Description:
Author: ascendgene
Session Name: 60genes panel chr19
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1554
1532505600 1554
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_Thaliana
Genome Assembly: hub_1936559_araTha1
Creation Date: 2019-08-29
Views: 8405
1567065600 8405
Description:
Author: ascendgene
Session Name: 60genes panel chr15
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1647
1532505600 1647
Description:
Author: dantaki
Session Name: sv2_merge_debug
Genome Assembly: hg19
Creation Date: 2018-11-08
Views: 1596
1541664000 1596
Description:
Author: dantaki
Session Name: ccr_hg19
Genome Assembly: hg19
Creation Date: 2018-12-12
Views: 1637
1544601600 1637
Description:
Author: ascendgene
Session Name: 60genes panel chr6
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1763
1532505600 1763
Description:
Author: danrlu
Session Name: Fuller_paper
Genome Assembly: dm6
Creation Date: 2019-10-25
Views: 1864
1571990400 1864
Description:
Author: mersedehr
Session Name: NSUN4_v2_rs66575205
Genome Assembly: hg19
Creation Date: 2018-06-15
Views: 1580
1529049600 1580
Description: This sessionView is a collection of tracks centered around epigenomics. The profiles displayed primarily belong to the H1 cell line, however different origin samples may be chosen in the track configurations. The display is organized with gene annotations and mRNA abundance first, followed by regulatory profiles in the form of <a href="https://www.ncbi.nlm.nih.gov/pubmed/21441907" target="_blank">chromatin states (ChromHMM)</a>. These data are followed by ChIP-seq tracks exploring various transcription factors and regulatory regions/promoter tracks looking at DNase/CpG/methylation. The final tracks are the <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx combined eQTL</a>, which identifies genetic variants likely affecting proximal gene expression, and the GTEx Gene Expression, which shows median gene expression levels in 51 tissues and 2 cell lines. The region visualized is a ~12,000bp window surrounding the <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1 gene</a> transcription start site. <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1</a> is a tumor suppressor and housekeeping gene linked to increased susceptibility to breast cancer when <a href="https://www.ncbi.nlm.nih.gov/pubmed/16846527" target="_blank">certain epigenomic markers are present</a>.
Author: view
Session Name: Epigenomics
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1701
1539158400 1701
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is a 294bp window looking at the CAG repeat linked to Huntington’s disease in the HTT gene. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity, and <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> which is the most informative clinical view.
Author: view
Session Name: ClinicalZoom
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 12904
1539158400 12904
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, a cancer mutation database and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a> which shows the bp resolution CAG repeat linked to Huntington's disease, as well as <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity.
Author: view
Session Name: Clinical
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 3381
1539158400 3381
Description: This sessionView is a collection of tracks centered around assembly support. The region displayed includes a reported GRC incident on hg19 which was then patched. It also showcases a gap which can lead to inconsistent or missing data on existing tracks; as seen by the Mappability and 1000 Genomes Project Accessible Regions tracks.
Author: view
Session Name: AssemblySupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 1639
1538726400 1639
Description:
Author: ascendgene
Session Name: 60genes panel chr13
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1800
1532505600 1800
Description:
Author: ascendgene
Session Name: 60genes panel chr12
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1633
1532505600 1633
Description:
Author: ascendgene
Session Name: 60genes panel chr10
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2000
1532419200 2000
Description:
Author: csitans
Session Name: Mouse ncRNA HSCs
Genome Assembly: mm9
Creation Date: 2017-06-19
Views: 1637
1497859200 1637
Description:
Author: cschee
Session Name: RNA_HEMa
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1971
1465891200 1971
Description:
Author: cschee
Session Name: RNA_A375
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1843
1465891200 1843
Description:
Author: cschee
Session Name: A375_K27me3
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 1835
1465891200 1835
Description:
Author: cschee
Session Name: A375_K27Ac
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 1852
1465977600 1852
Description:
Author: cschee
Session Name: A375_Input_21092016
Genome Assembly: hg19
Creation Date: 2016-09-21
Views: 1977
1474444800 1977
Description:
Author: cschee
Session Name: A375_Input
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 1792
1465977600 1792
Description:
Author: cosmid88
Session Name: SRY-SOX9-ChIP-Chip
Genome Assembly: mm8
Creation Date: 2013-06-29
Views: 2358
1372492800 2358
Description:
Author: ascendgene
Session Name: 60genes panel chr9
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1550
1532419200 1550
Description:
Author: cyoung
Session Name: Young, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-09-10
Views: 1602
1505030400 1602
Description:
Author: cyoung
Session Name: Fall17 Bio630 CY test
Genome Assembly: mm9
Creation Date: 2017-09-13
Views: 1601
1505289600 1601
Description:
Author: cyoung
Session Name: Bio630 CRX variants Young
Genome Assembly: hg38
Creation Date: 2017-09-26
Views: 1650
1506412800 1650
Description:
Author: ascendgene
Session Name: 60genes panel chr8
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1581
1532505600 1581
Description:
Author: ascendgene
Session Name: 60genes panel chr7
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1542
1532419200 1542
Description:
Author: ascendgene
Session Name: 60genes panel chr5
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1866
1532419200 1866
Description:
Author: ddunican
Session Name: MBD3 WT v KO medip-seq ion_torrent mm9
Genome Assembly: mm9
Creation Date: 2016-09-26
Views: 2031
1474876800 2031
Description:
Author: ascendgene
Session Name: 60genes panel chr4
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1717
1532419200 1717
Description:
Author: ascendgene
Session Name: 60genes panel chr3
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1609
1532419200 1609
Description:
Author: ascendgene
Session Name: 60genes panel chr2
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2014
1532419200 2014
Description:
Author: Welekie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-05-20
Views: 1264
1589961600 1264
Description:
Author: simonwang612
Session Name: worm_ChIP_seq_L4_0716
Genome Assembly: ce10
Creation Date: 2018-07-16
Views: 1634
1531728000 1634
Description:
Author: olena
Session Name: OTC-regulatory
Genome Assembly: hg19
Creation Date: 2018-07-13
Views: 1791
1531468800 1791
Description:
Author: jtm
Session Name: shiny_app_mm10_v1
Genome Assembly: mm10
Creation Date: 2018-07-11
Views: 2728
1531296000 2728
Description:
Author: jtm
Session Name: shiny_app_hg38_v1
Genome Assembly: hg38
Creation Date: 2018-07-11
Views: 4840
1531296000 4840
Description:
Author: Kyle@Arkell_Lab
Session Name: hg38_ZIC2_3'UTR_RNA_Annotation
Genome Assembly: hg38
Creation Date: 2018-07-10
Views: 1788
1531209600 1788
Description:
Author: tonyzeng
Session Name: apa
Genome Assembly: hg19
Creation Date: 2018-07-06
Views: 1858
1530864000 1858
Description:
Author: speese
Session Name: dm6 FlyVar track
Genome Assembly: dm6
Creation Date: 2018-07-05
Views: 1383
1530777600 1383
Description:
Author: Mouro_81
Session Name: B6J vs 129S1 SNPs at Lrrfip2/Mlh1
Genome Assembly: mm10
Creation Date: 2017-05-15
Views: 1832
1494835200 1832
Description:
Author: MeganDurham
Session Name: BRAF
Genome Assembly: hg19
Creation Date: 2018-04-24
Views: 1795
1524556800 1795
Description:
Author: Leif.Benner
Session Name: Leif_session
Genome Assembly: dm3
Creation Date: 2015-04-11
Views: 1785
1428739200 1785
Description:
Author: Lab252
Session Name: Roche_et_al_NAR_44_19_9315_2016
Genome Assembly: hg19
Creation Date: 2016-07-04
Views: 1931
1467619200 1931
Description:
Author: Kurotaki
Session Name: mm10 tachibana
Genome Assembly: mm10
Creation Date: 2016-05-12
Views: 1930
1463040000 1930
Description:
Author: Ketty
Session Name: hg38_ChiPseq CRISPR clones
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1480
1561017600 1480
Description:
Author: KateLawrensonCSHS
Session Name: OCAC_CIMBA_Oncoarray
Genome Assembly: hg19
Creation Date: 2016-05-03
Views: 2419
1462262400 2419
Description:
Author: Vizoso1
Session Name: UBP10
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1877
1500969600 1877
Description:
Author: Vizoso1
Session Name: RSA4
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1960
1500969600 1960
Description:
Author: Vizoso1
Session Name: NMD3
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1755
1500969600 1755
Description:
Author: Vizoso1
Session Name: ENP1
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1810
1500969600 1810
Description:
Author: Tung
Session Name: ndst1_10snp
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 1932
1523606400 1932
Screenshot not available
Click Here to view
Description:
Author: Toma Matveeva
Session Name: CGEMS #1
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1898
1469088000 1898
Screenshot not available
Click Here to view
Description:
Author: Tao Zhang
Session Name: chicken lncRNA
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-28
Views: 2130
1480320000 2130
Description:
Author: Robin
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 1878
1475568000 1878
Description:
Author: Robin
Session Name: CHPv3 versus Sanger/CHPv2
Genome Assembly: hg19
Creation Date: 2016-07-11
Views: 1789
1468224000 1789
Description:
Author: Rahman.team
Session Name: CART38A
Genome Assembly: hg38
Creation Date: 2018-10-30
Views: 1697
1540886400 1697
Description:
Author: Rahman.team
Session Name: CART37A
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 1723
1540886400 1723
Description:
Author: cocopow
Session Name: hg38_23676
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1388
1561017600 1388
Description:
Author: cocopow
Session Name: hg19_superDuperTrack
Genome Assembly: hg19
Creation Date: 2019-04-16
Views: 1681
1555401600 1681
Description:
Author: cocopow
Session Name: hg19_DMR_chr2
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1436
1554105600 1436
Description:
Author: cocopow
Session Name: hg19_DMR_1chr1_P180_P21_exm_3
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1426
1553155200 1426
Description:
Author: cocopow
Session Name: hg19_ChIA
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1458
1553155200 1458
Description:
Author: cocopow
Session Name: hg19_BedGraph
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1554
1553846400 1554
Description:
Author: cocopow
Session Name: danRer7_bw_GSM1131536
Genome Assembly: danRer7
Creation Date: 2019-03-07
Views: 1465
1551945600 1465
Description:
Author: britnyblu
Session Name: rena_atac_data
Genome Assembly: mm10
Creation Date: 2019-08-15
Views: 1396
1565856000 1396
Description:
Author: megallegos
Session Name: Biol 310: Module 2 TSS-seq
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 4848
1536048000 4848
Description:
Author: mjulialamberti
Session Name: cxcl12
Genome Assembly: hg38
Creation Date: 2019-08-08
Views: 1394
1565251200 1394
Description:
Author: [email protected]
Session Name: mm10 Linnarsson Celltype autoscale
Genome Assembly: mm10
Creation Date: 2019-02-18
Views: 759
1550476800 759
Description:
Author: masuping
Session Name: chr_lncRNA-seq_CPM
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1347
1571040000 1347
Description: Sept 10, 2024
Author: rchelsea
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-11
Views: 47
1726041600 47
Description:
Author: sajjeev
Session Name: foxa1_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1395
1563782400 1395
Screenshot not available
Click Here to view
Description:
Author: sajjeev
Session Name: ICR_cmyc_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1423
1563782400 1423
Screenshot not available
Click Here to view
Description:
Author: sajjeev
Session Name: 07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1343
1563782400 1343
Description:
Author: mauriege
Session Name: Fall21 Yeast test (GEM)
Genome Assembly: sacCer3
Creation Date: 2021-09-04
Views: 797
1630742400 797
Description:
Author: celiagonzalez98
Session Name: Class 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1277
1581321600 1277
Description:
Author: batra.anjali
Session Name: Spring19 Yeast test AB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1481
1547193600 1481
Description:
Author: ruhollah
Session Name: hg19_1025_chr5_nmtf14
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1374
1554105600 1374
Description:
Author: ruhollah
Session Name: hg19_830_chr6_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1396
1554105600 1396
Description:
Author: ruhollah
Session Name: hg19_750_chr19_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1384
1554105600 1384
Description:
Author: ruhollah
Session Name: hg19_199_chr8_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1399
1554105600 1399
Description:
Author: ruhollah
Session Name: hg19_1405_chr16_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1683
1554105600 1683
Description:
Author: ruhollah
Session Name: hg19_212_chr17_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1492
1554105600 1492
Description:
Author: ruhollah
Session Name: hg19_131_chr2_nmtf17
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1411
1554105600 1411
Description:
Author: ruhollah
Session Name: hg19_1163_chr1_nmtf18
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1457
1554105600 1457
Description:
Author: ruhollah
Session Name: hg19_414_Chr8_nmtf19
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1444
1554105600 1444
Description:
Author: ruhollah
Session Name: hg19_1617_chr1_nmtf20
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1442
1554105600 1442
Description:
Author: ruhollah
Session Name: hg19_795_chr19_nmtf23
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1427
1554105600 1427
Description: Tandemly repeated DNA sequences are widespread throughout the human genome and show sufficient variability among individuals in a population that they have become important in several fields including genetic mapping, linkage analysis, and human identity testing. These tandemly repeated regions of DNA are typically classified into several groups depending on the size of the repeat region. Minisatellites (variable number of tandem repeats, VNTRs) have core repeats with 9-80 bp, while microsatellites (short tandem repeats, STRs) contain 2-5 bp repeats. The forensic DNA community has moved primarily towards tetranucleotide repeats, which may be amplified using the polymerase chain reaction (PCR) with greater fidelity than dinucleotide repeats. The variety of alleles present in a population is such that a high degree of discrimination among individuals in the population may be obtained when multiple STR loci are examined.
Author: Hiram
Session Name: hg38.codis
Genome Assembly: hg38
Creation Date: 2018-05-10
Views: 1638
1525939200 1638
Description:
Author: Boody09
Session Name: Boudreau Lab_human cardiac Ago2 HITS-CLIP
Genome Assembly: hg19
Creation Date: 2018-05-08
Views: 1828
1525766400 1828
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;HCT116_vs_DKO1
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1363
1566460800 1363
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;Mouse_OE
Genome Assembly: mm9
Creation Date: 2019-08-22
Views: 1208
1566460800 1208
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;SH-SY5Y
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1272
1566460800 1272
Description:
Author: AlicePsyche
Session Name: zebrafish_enhancers
Genome Assembly: danRer7
Creation Date: 2018-04-04
Views: 1549
1522828800 1549
Description:
Author: tschauer
Session Name: Harpprecht_NAR
Genome Assembly: dm6
Creation Date: 2019-03-27
Views: 1475
1553673600 1475
Description:
Author: Boonede
Session Name: Spring19 Yeast Test DB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1536
1547193600 1536
Description:
Author: frongemg
Session Name: Spring19 Yeast test MGF
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1465
1547193600 1465
Description:
Author: ruhollah
Session Name: hg19_172Chr3_nmt8
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1618
1547452800 1618
Description:
Author: ruckerhr
Session Name: Spring19 Yeast HR
Genome Assembly: sacCer3
Creation Date: 2019-01-09
Views: 1513
1547020800 1513
Description:
Author: ruckerhr
Session Name: TAS2R8group4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1615
1547452800 1615
Description:
Author: Artem Babaian
Session Name: LIONS_ENCODE_supplement
Genome Assembly: hg19
Creation Date: 2019-01-09
Views: 1553
1547020800 1553
Description:
Author: gerbermm
Session Name: Spring19 Yeast test MG
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1583
1546934400 1583
Description:
Author: descentj
Session Name: Spring19YeastTestTD
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1608
1546934400 1608
Description:
Author: shashipujar
Session Name: Multiz_conservation_SP
Genome Assembly: hg38
Creation Date: 2018-06-18
Views: 1711
1529308800 1711
Description:
Author: agacita
Session Name: DYB_Promoter
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1507
1548144000 1507
Description:
Author: lbenner
Session Name: fs(1)K741
Genome Assembly: dm6
Creation Date: 2017-09-11
Views: 1718
1505116800 1718
Description:
Author: mersedehr
Session Name: NSUN4_v1_rs72886903
Genome Assembly: hg19
Creation Date: 2018-06-14
Views: 1514
1528963200 1514
Description:
Author: [email protected]
Session Name: DGRP2snp
Genome Assembly: dm3
Creation Date: 2018-06-14
Views: 1487
1528963200 1487
Description:
Author: Annaneed
Session Name: Anna_GEL
Genome Assembly: mm9
Creation Date: 2018-06-08
Views: 1231
1528444800 1231
Screenshot not available
Click Here to view
Description:
Author: view
Session Name: 11
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1552
1545379200 1552
Description:
Author: GDJ_Duke
Session Name: Layden_liver_ATACseq
Genome Assembly: mm10
Creation Date: 2018-12-16
Views: 1470
1544947200 1470
Description:
Author: nedbrewer66
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-12-18
Views: 1672
1545120000 1672
Description:
Author: mfarkas03
Session Name: 1299To p53 mutants
Genome Assembly: hg19
Creation Date: 2018-06-07
Views: 1148
1528358400 1148
Description:
Author: arem
Session Name: hg19-cc
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 1830
1549612800 1830
Description:
Author: arem
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 1932
1549612800 1932
Description:
Author: Mikhailova_li
Session Name: KB-1471A8.1
Genome Assembly: hg19
Creation Date: 2018-06-04
Views: 1784
1528099200 1784
Description:
Author: Mikhailova_li
Session Name: session 3
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1567
1528012800 1567
Description:
Author: Mikhailova_li
Session Name: session 1
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1568
1528012800 1568
Description:
Author: brianlee
Session Name: hg38_chrM
Genome Assembly: hg38
Creation Date: 2018-06-01
Views: 1632
1527840000 1632
Description: Our LOVD Variants track has variants from many LSDBs; our OMIM Alleles, GWAS Catalog, ClinVar Variants and other tracks in the Phenotypes & Literature group may provide clues to when a SNP is Clinical (LSDB,OMIM,TPA,Diagnostic)" per the Flagged SNPs track based on whether dbSNP's true-or-false "clinically-assoc" flag is set from NCBI's documentation.
Author: brianlee
Session Name: hg19_variants
Genome Assembly: hg19
Creation Date: 2018-06-01
Views: 1762
1527840000 1762
Description:
Author: nehoralevi
Session Name: CTCF- macs2 control2
Genome Assembly: mm10
Creation Date: 2019-06-10
Views: 1387
1560153600 1387
Description: Epigenome map of human fetal and iPSC-derived retinal pigment epithelium (RPE)
Author: s041629
Session Name: iPSCORE_RPE_session_hg19
Genome Assembly: hg19
Creation Date: 2018-05-31
Views: 2001
1527753600 2001
Description: This session highlights data from the Brain Epigenome Hub, created by Peter Hickey, Lindsay Rizzardi, and Kaspar Hansen and others at Johns Hopkins University. The hub shows methylation, ATAC-seq, and RNAseq across different brain regions.
Author: chmalee
Session Name: hg19_brainEpigenome
Genome Assembly: hg19
Creation Date: 2018-05-30
Views: 2734
1527667200 2734
Description:
Author: rezo
Session Name: ReCappable-seq
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 7114
1565510400 7114
Description: 6 CLEAR-CLIP tracks from mouse keratinocytes in total. 3 showing CLEAR-CLIP reads from all miRNAs and 3 showing only miR-200 family specific reads. For each set of three there are Controls, miR-200 DKO and miR-200 inducible libraries.
Author: Bjerkega
Session Name: Bjerkega CLEAR-CLIP
Genome Assembly: mm10
Creation Date: 2019-10-04
Views: 1530
1570176000 1530
Description:
Author: ltoker
Session Name: Marzi
Genome Assembly: hg19
Creation Date: 2021-01-05
Views: 1260
1609833600 1260
Description:
Author: carlchancc
Session Name: 20191017_MC_Forelimb_Hindlimb_hg19
Genome Assembly: hg19
Creation Date: 2019-10-17
Views: 1493
1571299200 1493
Description:
Author: hkao
Session Name: RHOA 2-2
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1343
1562659200 1343
Description:
Author: hkao
Session Name: NEFM 1-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1379
1562659200 1379
Description:
Author: ejlopezsoto
Session Name: Cacna1b e35-e41
Genome Assembly: hg19
Creation Date: 2019-07-11
Views: 1542
1562832000 1542
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Tracks provided for age, sex and sample month.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele components
Genome Assembly: wuhCor1
Creation Date: 2020-04-29
Views: 1453
1588147200 1453
Description:
Author: eldadshulman
Session Name: Homer_newaproch
Genome Assembly: mm10
Creation Date: 2019-06-30
Views: 1337
1561881600 1337
Description:
Author: ruhollah
Session Name: hg19_162Chr19_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1445
1547452800 1445
Description:
Author: 704855238
Session Name: chip-seq_LiuZX_seh1
Genome Assembly: rn6
Creation Date: 2018-05-24
Views: 1654
1527148800 1654
Description:
Author: zhangr100
Session Name: AHBEC_VitD
Genome Assembly: hg19
Creation Date: 2019-04-04
Views: 1470
1554364800 1470
Description:
Author: liqing9102
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-05-16
Views: 1639
1526457600 1639
Description:
Author: avlasova
Session Name: tADseq.short-library.all_frames
Genome Assembly: hub_271523_TFbb_list180_linear
Creation Date: 2018-05-14
Views: 1727
1526284800 1727
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome 2
Genome Assembly: hg19
Creation Date: 2020-02-27
Views: 1231
1582790400 1231
Description:
Author: Vaa2001
Session Name: hg19_ASXL1Gen
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1303
1571904000 1303
Description: one fly one genome: H3 hybrid fly, hybrid genome sequencing and assembly
Author: msadams
Session Name: H3-2_dm6
Genome Assembly: dm6
Creation Date: 2019-10-24
Views: 452
1571904000 452
Screenshot not available
Click Here to view
Description:
Author: eldadshulman
Session Name: endVsStart_chr1_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1368
1525334400 1368
Screenshot not available
Click Here to view
Description:
Author: eldadshulman
Session Name: apa_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1288
1525334400 1288
Description:
Author: ruhollah
Session Name: hg19_148Chr2_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1385
1547452800 1385
Description:
Author: che7oz
Session Name: hg19-IRF8-DCCC
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1608
1538553600 1608
Description:
Author: estercastillo
Session Name: Reprogenetics_PGD
Genome Assembly: hg19
Creation Date: 2018-04-27
Views: 1568
1524816000 1568
Description:
Author: lob5149
Session Name: TSC2
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1806
1524729600 1806
Description:
Author: lob5149
Session Name: AKT1
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1596
1524729600 1596
Description:
Author: lob5149
Session Name: MTOR
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1544
1524729600 1544
Description:
Author: estercastillo
Session Name: JuanMartinez_LifeSeq_AS
Genome Assembly: hg19
Creation Date: 2018-04-22
Views: 1758
1524384000 1758
Description:
Author: prutten
Session Name: rs6702619_3C-Seq_2replicates
Genome Assembly: hg19
Creation Date: 2015-03-17
Views: 1645
1426579200 1645
Description:
Author: estercastillo
Session Name: Lara_AS_LaPaz
Genome Assembly: hg19
Creation Date: 2018-04-19
Views: 1691
1524124800 1691
Description:
Author: roseaux12
Session Name: jinliying_nk
Genome Assembly: hg19
Creation Date: 2018-08-22
Views: 1619
1534924800 1619
Description:
Author: celiagonzalez98
Session Name: class 3 part 1
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1224
1581494400 1224
Description:
Author: arthurcheng
Session Name: hg38 ATAC-seq
Genome Assembly: hg38
Creation Date: 2019-01-23
Views: 862
1548230400 862
Description:
Author: riguang zhao
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2019-03-12
Views: 1432
1552377600 1432
Description:
Author: Xavier Rambout
Session Name: mm9 2019-03-11
Genome Assembly: mm9
Creation Date: 2019-03-11
Views: 1257
1552291200 1257
Description:
Author: ruhollah
Session Name: hg19_128Chr19+167Chr19_nmt11+11
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1449
1547452800 1449
Description:
Author: Camila
Session Name: Enhancers-BreastCancersCells
Genome Assembly: hg19
Creation Date: 2018-04-21
Views: 1539
1524297600 1539
Description:
Author: micca
Session Name: mm9_Buecker2014
Genome Assembly: mm9
Creation Date: 2018-04-03
Views: 1555
1522742400 1555
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. Only the "UCSC Genes" track is enabled, showing two of the gene's potential isoforms. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 554
1658390400 554
Description:
Author: Jcotney
Session Name: Mouse_chromhmm_15_18_state
Genome Assembly: mm10
Creation Date: 2018-10-20
Views: 640
1540022400 640
Description:
Author: arem
Session Name: colon meth
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1348
1551859200 1348
Description:
Author: jtm
Session Name: shiny_app_hg38_v0
Genome Assembly: hg38
Creation Date: 2018-03-28
Views: 4106
1522224000 4106
Description:
Author: Hanson258
Session Name: DNA Damage ChIP-seq
Genome Assembly: hg38
Creation Date: 2018-07-17
Views: 2210
1531814400 2210
Description:
Author: ldistefano
Session Name: dm6_DiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1328
1552377600 1328
Screenshot not available
Click Here to view
Description:
Author: jtm
Session Name: shiny_app_mm10_v0
Genome Assembly: mm10
Creation Date: 2018-04-04
Views: 2078
1522828800 2078
Description:
Author: cocopow
Session Name: hg38_nucs
Genome Assembly: hg38
Creation Date: 2019-04-23
Views: 1355
1556006400 1355
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: videoDemo1
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 1640
1520928000 1640
Description:
Author: nehoralevi
Session Name: mm10-CTCF
Genome Assembly: mm10
Creation Date: 2019-06-03
Views: 2064
1559548800 2064
Description: The GeneHancer database links human regulatory elements (enhancers and promoters) as arcs to their inferred target genes. Over 1 million regulatory elements obtained from seven genome-wide databases by GeneHancer are visualizable on the human hg19 and hg38 assemblies as color-coded curves ending on their respective targets. Read more about GeneHancer data on the track description page and this article <a href="https://www.ncbi.nlm.nih.gov/pubmed/28605766">GeneHancer: genome-wide integration of enhancers and target genes in GeneCards.</a>
Author: PublicSessions
Session Name: GeneHancer
Genome Assembly: hg38
Creation Date: 2019-05-31
Views: 1684
1559289600 1684
Description:
Author: [email protected]
Session Name: extended BACs and FOSMIDs
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1616
1553673600 1616
Description:
Author: AnaïsTest
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 1782
1559808000 1782
Description:
Author: brianlee
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 1628
1559808000 1628
Description:
Author: emmawentworth
Session Name: hg19-PWS
Genome Assembly: hg19
Creation Date: 2019-06-05
Views: 1734
1559721600 1734
Description:
Author: cocopow
Session Name: mm10_altStrains
Genome Assembly: mm10
Creation Date: 2019-06-05
Views: 1379
1559721600 1379
Description:
Author: evan_pepper
Session Name: extra_tRNAs_Analysis
Genome Assembly: hg19
Creation Date: 2018-03-08
Views: 1674
1520496000 1674
Description:
Author: hchen17
Session Name: 20180307_1300_RESULTS_6pelvicFinStickleOut
Genome Assembly: hub_207981_oryLat03
Creation Date: 2018-03-07
Views: 1514
1520409600 1514
Description:
Author: lboteva
Session Name: mm10_rif1_HP_
Genome Assembly: mm10
Creation Date: 2019-05-30
Views: 1593
1559203200 1593
Description:
Author: lbennett
Session Name: impdh1retina
Genome Assembly: hg19
Creation Date: 2018-03-06
Views: 1618
1520323200 1618
Description:
Author: ruhollah
Session Name: 12_ruh
Genome Assembly: hg38
Creation Date: 2018-11-13
Views: 1443
1542096000 1443
Description:
Author: ruhollah
Session Name: hg19_2_chr8
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1471
1543219200 1471
Description:
Author: yezheng
Session Name: HiC_ChIP-seq_short
Genome Assembly: hg19
Creation Date: 2018-03-04
Views: 1668
1520150400 1668
Description:
Author: holdenl
Session Name: danRer11 zebrafish CNV across strains
Genome Assembly: danRer11
Creation Date: 2018-03-03
Views: 2099
1520064000 2099
Description:
Author: estercastillo
Session Name: MartaRodriguez_Reus
Genome Assembly: hg19
Creation Date: 2018-02-28
Views: 1777
1519804800 1777
Description:
Author: BenjaminMartin02
Session Name: Stefanska_data
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 1976
1518595200 1976
Description:
Author: labrozam
Session Name: CGEMS Yeast AL
Genome Assembly: sacCer3
Creation Date: 2016-11-05
Views: 1875
1478332800 1875
Description:
Author: labrozam
Session Name: CGEMS Worm AL test
Genome Assembly: ce11
Creation Date: 2016-11-20
Views: 1744
1479628800 1744
Description:
Author: labrozam
Session Name: CGEMS Mouse AL test
Genome Assembly: mm9
Creation Date: 2016-11-29
Views: 2420
1480406400 2420
Description:
Author: labrozam
Session Name: CGEMS Human AL test
Genome Assembly: hg38
Creation Date: 2016-11-21
Views: 1732
1479715200 1732
Description:
Author: labrozam
Session Name: Anna-rs72802342
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 1996
1509436800 1996
Description:
Author: jwjiao
Session Name: H2ZKO_E16_WT_E16
Genome Assembly: hg38
Creation Date: 2018-02-26
Views: 1632
1519632000 1632
Description:
Author: [email protected]
Session Name: MMR_branchpoints-230218
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1578
1519286400 1578
Description:
Author: yierjin_2008
Session Name: KMS12BM
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1698
1519286400 1698
Description: This session is an example of using the Short Match track to search a sequence in the current view with the IUPAC codes. The input of WACMKGTW catches two matches. The session also using a feature of the Base Position track. You can highlight specific nucleotides with that track and AAC are selected to be highlighted (note, there is also a step taken to check the box to show reverse complements of motifs). This region you will see AACATGTT and another reverse strand AACCTGTA, which appears to work with the IUPAC codes: http://genome.ucsc.edu/goldenPath/help/iupac.html The Base Track and the Short Match track allow you to investigate the sequence in the current view when zoomed in with these highlight and search features.
Author: brianlee
Session Name: hg38.WACMKGTW
Genome Assembly: hg38
Creation Date: 2018-02-21
Views: 837
1519200000 837
Description:
Author: simonwang612
Session Name: worm-chip-L4
Genome Assembly: ce10
Creation Date: 2018-02-20
Views: 1597
1519113600 1597
Description:
Author: simonwang612
Session Name: worm-chip
Genome Assembly: ce10
Creation Date: 2018-02-19
Views: 1754
1519027200 1754
Description:
Author: estercastillo
Session Name: JudithArmstrong_predisposicio
Genome Assembly: hg19
Creation Date: 2018-02-18
Views: 1577
1518940800 1577
Description:
Author: Mannu Walia
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1603
1544688000 1603
Description:
Author: AnUnroyalKing
Session Name: Gene_File_King
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 1546
1518681600 1546
Description:
Author: cmhct7
Session Name: Mouse Quad Data
Genome Assembly: mm10
Creation Date: 2016-09-12
Views: 1813
1473667200 1813
Description:
Author: clauhag
Session Name: ContactSites_mixedpopulations
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 1977
1482048000 1977
Description:
Author: clauhag
Session Name: ContactSites_clones
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 1897
1482048000 1897
Description:
Author: ascendgene
Session Name: 60genes panel chr11
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1723
1532505600 1723
Description:
Author: zunpengliu66
Session Name: WT and DGCR8_dex2 H3K9me3 ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-04-11
Views: 1521
1523433600 1521
Description:
Author: samross
Session Name: danRer7_48hpf_6dpfbrain_RRBS
Genome Assembly: danRer7
Creation Date: 2018-02-14
Views: 1556
1518595200 1556
Description:
Author: Lorena8a
Session Name: trabajo genomics HSC
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 1679
1518595200 1679
Description:
Author: oac7
Session Name: oac7_hg19_all_snvs
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1716
1518508800 1716
Description:
Author: AnUnroyalKing
Session Name: Ian_King_Settings
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1766
1518508800 1766
Description:
Author: marzoldr
Session Name: hg38 MAPT density graphs and such
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1590
1518508800 1590
Description:
Author: marzoldr
Session Name: hg38 MAPT alleles
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1584
1518508800 1584
Description:
Author: marzoldr
Session Name: hg19 RHO custom 1
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1579
1518508800 1579
Description: This assembly hub for the CG2 clonal zebrafish is part of a much larger collection of assembly hubs. The hub details can be found on the gateway page for this hub <a href="http://genome.ucsc.edu/cgi-bin/hgGateway?hubUrl=http://genome-test.cse.ucsc.edu/gbdb/hubs/genbank/vertebrate_other/hub.ncbi.txt&genome=GCA_001483285.1_CG2v1.0&position=lastDbPos" >found here.</a> The hub is Biosample: SAMN03964926 and has Assembly accession ID: GCA_001483285.1. <br> <br> The hub is is part of this much larger assembly hub collection, with a launching page <a href="http://genome-test.cse.ucsc.edu/~hiram/hubs/genbank/vertebrate_mammalian/vertebrate_mammalian.ncbi.html" >found here</a> (note these will launch on our test development site as this hub is considered a prototype and hasn't passed quality control). Once connected to the above hub you have access to all of these hubs, the launching page only makes it more easy to directly link to the Track Browsing page. When connected one can also go to the Gateway page (earlier link) and see a <b>Download files for this assembly hub:</b> section with a <code>wget</code> command to access all the files for these assembly hubs.
Author: brianlee
Session Name: CG2zebrafish
Genome Assembly: hub_89563_GCA_001483285.1_CG2v1.0
Creation Date: 2018-07-06
Views: 1593
1530864000 1593
Description:
Author: AnUnroyalKing
Session Name: King_setting
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 1825
1518681600 1825
Description:
Author: estercastillo
Session Name: pseudogens
Genome Assembly: hg19
Creation Date: 2018-01-31
Views: 2361
1517385600 2361
Description:
Author: marylaws
Session Name: foxm1 chip comparison
Genome Assembly: hg19
Creation Date: 2018-02-07
Views: 1560
1517990400 1560
Description:
Author: marylaws
Session Name: FOXM 231 and mcf7
Genome Assembly: hg18
Creation Date: 2018-02-07
Views: 1899
1517990400 1899
Description: This session illustrates the meaning of columns in the axt file definition here, http://genome.ucsc.edu/goldenPath/help/axt.html You can see that indeed if you subtract to find the differences in the primary organism coordinates (panTro4: 78679-77637 = 1,042) it will be different than the values in the aligning organism coordinates (hg19: 88869-87772 = 1,097), but in the primary assembly sequence line you can see where there isn't a match in more than one place (most notable gct---------------------------------------------------ctt) as seen in this alignment of hg19 to panTro4. See the mailing list question here: <a href="https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/-ohoSCyPIT0/c5nP7NzOBQAJ">link</a>.
Author: brianlee
Session Name: hg19.panTro4
Genome Assembly: hg19
Creation Date: 2018-02-02
Views: 1533
1517558400 1533
Description:
Author: marzoldr
Session Name: TAS2R38 (T1)
Genome Assembly: hg19
Creation Date: 2018-01-23
Views: 1849
1516694400 1849
Description:
Author: yezheng
Session Name: ATAC-seq_ALA_mm9
Genome Assembly: mm9
Creation Date: 2018-01-25
Views: 1683
1516867200 1683
Description:
Author: Colin Logie
Session Name: forsubmission2bioRxiv_new
Genome Assembly: hg19
Creation Date: 2018-01-22
Views: 1682
1516608000 1682
Description:
Author: ascendgene
Session Name: hg19_chr16:21960001-22400001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 1643
1516521600 1643
Description:
Author: chouhj
Session Name: noCHX_2017
Genome Assembly: sacCer3
Creation Date: 2017-08-14
Views: 1662
1502697600 1662
Description:
Author: chouhj
Session Name: 46Del_2016batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 1689
1483603200 1689
Description:
Author: chouhj
Session Name: 11Del_2015batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 1884
1483603200 1884
Description:
Author: chmalee
Session Name: hg38notableChrYFeatures
Genome Assembly: hg38
Creation Date: 2017-03-06
Views: 1857
1488787200 1857
Description:
Author: ascendgene
Session Name: hg19_chr15:32,020,001-32,420,001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 2172
1516521600 2172
Description:
Author: FrankaRang
Session Name: FR180123_mm10_groupmeeting
Genome Assembly: mm10
Creation Date: 2018-01-23
Views: 1907
1516694400 1907
Description:
Author: zheyangshan
Session Name: EGFR BOTH
Genome Assembly: hg19
Creation Date: 2018-12-14
Views: 1357
1544774400 1357
Description:
Author: rnaguru
Session Name: mm9-pY-MEME
Genome Assembly: mm9
Creation Date: 2018-01-18
Views: 1792
1516262400 1792
Description: This assembly hub has a sequence that translates into a fun message when looking at codon translations.
Author: brianlee
Session Name: PAG_FUN
Genome Assembly: hub_211929_yourGenome
Creation Date: 2018-01-16
Views: 1759
1516089600 1759
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage10.WT.Clone5.DKO.clone7
Genome Assembly: mm10
Creation Date: 2018-01-12
Views: 1567
1515744000 1567
Description:
Author: marzoldr
Session Name: Spring18 Yeast Test DMLJ
Genome Assembly: sacCer3
Creation Date: 2018-01-09
Views: 1571
1515484800 1571
Description: This session shows TRPV3 which researchers believe is involved in our ability to sense and detect warm temperature. Scripps Research Institute scientists have demonstrated that mice lacking the TRPV3 protein have specific deficiencies in their ability to detect temperatures.
Author: brianlee
Session Name: skin_heat_sense
Genome Assembly: hg19
Creation Date: 2022-01-03
Views: 503
1641196800 503
Description:
Author: megas
Session Name: hg19 Chip-Seq Encode vs mm10
Genome Assembly: hg19
Creation Date: 2018-01-02
Views: 1756
1514880000 1756
Description: test the details .
Author: greece2019
Session Name: hg19_b0b1
Genome Assembly: hg19
Creation Date: 2019-03-03
Views: 1596
1551600000 1596
Description:
Author: jkrakowiak
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-12-18
Views: 2051
1513584000 2051
Description:
Author: jwjiao
Session Name: rbm3
Genome Assembly: mm10
Creation Date: 2017-12-17
Views: 1593
1513497600 1593
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rheMac2 circRNA annotation
Genome Assembly: rheMac2
Creation Date: 2016-09-25
Views: 1155
1474790400 1155
Description:
Author: mazawm
Session Name: hg#19RHO
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1373
1542096000 1373
Description:
Author: Heywhoyou22
Session Name: Nrl and wt Cbr sites
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1430
1542096000 1430
Description:
Author: nedbrewer66
Session Name: NAT7
Genome Assembly: hg38
Creation Date: 2018-12-28
Views: 1426
1545984000 1426
Description:
Author: caojun
Session Name: Amr-20161031
Genome Assembly: mm9
Creation Date: 2016-10-31
Views: 1787
1477900800 1787
Description:
Author: butlertj3
Session Name: nuc_g4
Genome Assembly: hg38
Creation Date: 2018-06-05
Views: 1806
1528185600 1806
Description:
Author: butlertj3
Session Name: mtDNA_G4_homo_hetero
Genome Assembly: hg38
Creation Date: 2018-04-10
Views: 1688
1523347200 1688
Description:
Author: brianlee
Session Name: sacCer3_spots
Genome Assembly: sacCer3
Creation Date: 2017-10-31
Views: 1769
1509436800 1769
Description:
Author: brianlee
Session Name: hg38_interact_example
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 1459
1541404800 1459
Description:
Author: brianlee
Session Name: hg38_GTEX_SUN
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 1646
1523606400 1646
Description:
Author: brianlee
Session Name: hg38.exampleTracks
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 1593
1497945600 1593
Description:
Author: brianlee
Session Name: hg38.SIRT1.relatedExpression
Genome Assembly: hg38
Creation Date: 2017-05-23
Views: 2059
1495526400 2059
Description:
Author: brianlee
Session Name: hg19.pgSnpExample
Genome Assembly: hg19
Creation Date: 2017-07-19
Views: 1586
1500451200 1586
Description:
Author: brianlee
Session Name: hg19.longTabix
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 1680
1495612800 1680
Description: This session shows a search of primers. A researcher had an issue building PCR primers and Browser staff discovered that a desired reverse primer falls into an area of repeats.  The original primer at 20 bases was near the limit of BLAT's sensitivity. With such short sequences, if BLAT has an over-used tile, a section of the query used to match and trigger an alignment, the algorithm will not be able to seed and extend an original BLAT hit in an area of repeats, which was what was likely happening to the reverse primer sequence in this session. In the session a larger BLAT query will result in a hit. Since primers are typically chosen from unique locations, Browser staff suggested it might be best to avoid a repeat-region, and noted that the nearby chr13:50,593,214-50,593,267 section appears to not have any repeats.
Author: brianlee
Session Name: Primers Blat Search
Genome Assembly: hg19
Creation Date: 2013-07-23
Views: 422
1374566400 422
Description: This FORWARD strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds FORWARD
Genome Assembly: hg19
Creation Date: 2013-08-01
Views: 295
1375344000 295
Description: This REVERSE strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds
Genome Assembly: hg19
Creation Date: 2013-07-31
Views: 267
1375257600 267
Description:
Author: bisrat
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2017-12-14
Views: 1619
1513238400 1619
Description:
Author: bisrat
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-18
Views: 1851
1537257600 1851
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1516
1536048000 1516
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1462
1542096000 1462
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1485
1542096000 1485
Description:
Author: benbeijs
Session Name: ENCODE Exercise
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1449
1542096000 1449
Description:
Author: benbeijs
Session Name: DSP (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 1530
1536134400 1530
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), Exercise 3
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1453
1538467200 1453
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage.Higher.10
Genome Assembly: mm10
Creation Date: 2017-12-12
Views: 1619
1513065600 1619
Description:
Author: nicklewis
Session Name: AMD SNP Second Try
Genome Assembly: hg19
Creation Date: 2017-11-02
Views: 1551
1509609600 1551
Description:
Author: nicklewis
Session Name: AMD SNP Custom Tracks
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1573
1509436800 1573
Description:
Author: cocapo
Session Name: hg38_multiWig_noOverlay
Genome Assembly: hg38
Creation Date: 2018-12-13
Views: 1427
1544688000 1427
Description:
Author: roseaux12
Session Name: 3_subset_nk
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1434
1544688000 1434
Description:
Author: abner_lim
Session Name: OVcar
Genome Assembly: hg19
Creation Date: 2018-12-09
Views: 1464
1544342400 1464
Description:
Author: GenePeeks
Session Name: .2017.12 60bp Multi-Seq-Alg
Genome Assembly: hg19
Creation Date: 2017-12-10
Views: 1484
1512892800 1484
Description:
Author: rnkeith
Session Name: dm6_first_ribo-seq
Genome Assembly: dm6
Creation Date: 2019-05-02
Views: 1291
1556784000 1291
Description:
Author: cath
Session Name: v440hgw0Test
Genome Assembly: hg38
Creation Date: 2016-10-25
Views: 1652
1477382400 1652
Description:
Author: cath
Session Name: MLQ19469
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 1996
1495612800 1996
Description: These are the 12 UCSC Browser tracks for the RNA-seq experiment in which humanized and WT yeast were subjected to 1 hour of splicing inhibitors. There are six libraries in duplicate. humanized hsh155 with DMSO carrier humanized hsh155 with 5 uM pladienolide-b humanized hsh155 with 0.5 uM pladienolide-b humanized hsh155 with 5 uM thailanstatin-a WT Hsh155 with DMSO carrier WT Hsh155 with 5 uM pladienolide-b
Author: ohunter
Session Name: Hunter_et_al_sacCer3_Yeast_Splicing_Inhibition
Genome Assembly: sacCer3
Creation Date: 2023-07-25
Views: 379
1690272000 379
Description:
Author: cocopow
Session Name: hg18_44way
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1435
1563955200 1435
Description:
Author: kinerettaler
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2018-12-30
Views: 1436
1546156800 1436
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. The interactions track in the pack setting allows for a pack view of the data with the direction and name of individual endpoints clearly displayed. A highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancerPack
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1297
1553846400 1297
Description: The JASPAR 2018 TFB Public Hub represents genome-wide predicted binding sites for TF (transcription factor) binding profiles in the JASPAR CORE vertebrates collection. Please click into the Track Description pages to see more details and credits and contacts for the hub's data.
Author: brianlee
Session Name: hg38.JASPARhub
Genome Assembly: hg38
Creation Date: 2017-09-29
Views: 2283
1506672000 2283
Description: With this session loaded navigate to the Variant Annotation Integrator (VAI) tool (under the top blue bar Tools menu). Then scroll down and click the "Get results" button to experience how the VAI tool can now output HGVS terms. This session is loaded with an artificial input of variants on the human hg38 assembly with NCBI RefSeq Genes track (curated NM_*, NR_*, and YP_* subset) filtered for coding exons and splice site roles and on DNase regulatory elements with output in HTML Variant Effect Predictor format where the "Extra" column will include HGVS notation. Please note that a semi-colon ";" will separate results in that field (HGVSG=NC_000010.11:g.27005592_27005594delAGA; HGVSCN=NM_014915.2:c.5129_5131delTCT; EXON=34/34).
Author: brianlee
Session Name: hg38.exampleVAI
Genome Assembly: hg38
Creation Date: 2017-09-25
Views: 4250
1506326400 4250
Description:
Author: rasou2ba
Session Name: Bio 630 CRX variants Rasoul
Genome Assembly: hg38
Creation Date: 2017-09-27
Views: 1516
1506499200 1516
Description:
Author: lianeslaughter
Session Name: mm9-Locus3_primerDesign
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 1602
1506412800 1602
Description:
Author: Cong Guo
Session Name: IDEAS Blank
Genome Assembly: hg19
Creation Date: 2017-09-26
Views: 1500
1506412800 1500
Description:
Author: Lou
Session Name: pisOchAsseblyHub
Genome Assembly: hub_1100339_12Jun2017_28pcJ
Creation Date: 2019-04-22
Views: 1608
1555920000 1608
Description:
Author: peytonse
Session Name: Bio 630 CRX variants Peyton
Genome Assembly: hg38
Creation Date: 2017-09-20
Views: 1591
1505894400 1591
Description:
Author: nickcochran
Session Name: BE2C_MAPT_9-18-17
Genome Assembly: hg19
Creation Date: 2017-09-18
Views: 1856
1505721600 1856
Description:
Author: morotz
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-09-14
Views: 1673
1505376000 1673
Description:
Author: EvansLab
Session Name: EY_ATAC_Ileum
Genome Assembly: mm9
Creation Date: 2017-09-12
Views: 1572
1505203200 1572
Description:
Author: mcgaughey
Session Name: mm10_retina_epigenetics
Genome Assembly: mm10
Creation Date: 2017-08-11
Views: 1819
1502438400 1819
Description:
Author: yezheng
Session Name: HiC_ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-03-02
Views: 1560
1519977600 1560
Description:
Author: leggeteg
Session Name: Leggett, BIO480Uba1 example
Genome Assembly: hg19
Creation Date: 2017-09-06
Views: 1587
1504684800 1587
Description:
Author: ofery1984
Session Name: FINAL Meth + RNA
Genome Assembly: mm10
Creation Date: 2017-09-06
Views: 984
1504684800 984
Description:
Author: mccarthyti
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-08-30
Views: 1633
1504080000 1633
Description:
Author: jcarlevaro
Session Name: TE_paper_hg38
Genome Assembly: hg38
Creation Date: 2017-08-28
Views: 1546
1503907200 1546
Description: We are pleased to add the UniBind Hub to our list of publicly available track hubs. UniBind is a comprehensive map of direct transcription factor - DNA interactions in the human genome. UniBind expands on the previous data and is now available on GRCh38/hg38. Below is a session highlighting UniBind transcription factor-DNA binding interactions in the SPR gene. http://genome.ucsc.edu/s/dschmelt/UniBindSRF More info on UniBind: https://unibind.uio.no We would like to thank the Mathelier Lab at the University of Oslo for creating this hub!
Author: dschmelt
Session Name: UniBindSRF
Genome Assembly: hg38
Creation Date: 2019-04-17
Views: 2249
1555488000 2249
Description:
Author: oac7
Session Name: oac7_Problem_Set_2
Genome Assembly: hg19
Creation Date: 2018-03-01
Views: 1550
1519891200 1550
Description: This data includes Bcl11b ChIP-seq result.
Author: liuxiaoqin
Session Name: bcl11b-liuxiaoqin
Genome Assembly: mm10
Creation Date: 2022-08-17
Views: 432
1660723200 432
Description:
Author: aniclem
Session Name: Clem, BIO480 Uba 1 example
Genome Assembly: hg19
Creation Date: 2017-09-03
Views: 1589
1504425600 1589
Description:
Author: EvansLab
Session Name: Eiji-ATACseq2
Genome Assembly: hg19
Creation Date: 2017-07-10
Views: 1765
1499673600 1765
Description:
Author: EvansLab
Session Name: EY_ATAC_Intes_Organoids
Genome Assembly: mm9
Creation Date: 2017-07-26
Views: 1902
1501056000 1902
Description: Visualization in UCSC Genome Browser of genome coverages of all generated next-generation sequencing data included in the manuscript ('A novel approach for DNA footprinting using short double-stranded cell-free DNA from plasma').
Author: jnmllr
Session Name: Short_cfDNA_seq_manuscript
Genome Assembly: hg19
Creation Date: 2024-02-13
Views: 123
1707811200 123
Description:
Author: svadlamudi
Session Name: KSR2_7-24-17
Genome Assembly: hg19
Creation Date: 2017-07-24
Views: 1731
1500883200 1731
Description:
Author: jwjiao
Session Name: H2AZ-ChIP-E13-Cortex
Genome Assembly: mm10
Creation Date: 2017-07-13
Views: 1739
1499932800 1739
Description: This session is a response to question for research on Myc binding sites on the IDH1 gene promoter, with a desire to analyze the conservation of Myc binding sites between human and mouse. In the session Transcription Factor ChIP-seq (161 factors) from ENCODE track is displayed and three MYC binding spots represented. This clustered transcription factor binding track can be sorted to display only certain factors like MYC. Below the MYC binding spots (wgEncodeRegTfbsClusteredV3 track) the conservation data from 100 assembly alignments are displayed (cons100way track), with the specific data from mouse selected. Further below that the Chain/Net data (placentalChainNet track) specific for mouse are also displayed. To see this question on our Mailing List click this link: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/94u1jx2bk6c/py3OD90WAQAJ
Author: brianlee
Session Name: hg19.mycBinding2
Genome Assembly: hg19
Creation Date: 2017-07-13
Views: 1655
1499932800 1655
Description:
Author: cocopow
Session Name: rn6_23676
Genome Assembly: rn6
Creation Date: 2019-06-20
Views: 1522
1561017600 1522
Description:
Author: cocopow
Session Name: hg19_hubs
Genome Assembly: hg19
Creation Date: 2019-06-18
Views: 1314
1560844800 1314
Description:
Author: Adhil
Session Name: sacCer3_supercoiling
Genome Assembly: sacCer3
Creation Date: 2019-06-17
Views: 1377
1560758400 1377
Description:
Author: Joey Riepsaame
Session Name: mm9 DNAseI digital Me1 Me3 Ac27 Pol2
Genome Assembly: mm9
Creation Date: 2015-07-14
Views: 1041
1436860800 1041
Description:
Author: janzop
Session Name: hsa_all_cccDNA_HBx_mRNA
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 2146
1497945600 2146
Description:
Author: phageghost
Session Name: glasslab_microglia_hg38
Genome Assembly: hg38
Creation Date: 2017-06-19
Views: 1803
1497859200 1803
Description:
Author: phageghost
Session Name: glasslab_microglia_mm10
Genome Assembly: mm10
Creation Date: 2017-06-19
Views: 1585
1497859200 1585
Description: This sessionView is a collection of tracks centered around gene expression. The display is organized with gene annotations first, followed by mRNA and smRNA evidence. Following these data are <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx tracks</a> which display median gene expression and transcripts from 51 tissues and 2 cells lines. The final tracks in this collection provide additional expression support: TSS/Dnase/chromatin state. The region visualized is a ~10,200bp window covering two <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1891803/" target="_blank">HOX genes</a> which are regulators for embryonic development and continue to be expressed throughout postnatal life.
Author: view
Session Name: Expression
Genome Assembly: hg19
Creation Date: 2018-10-08
Views: 1548
1538985600 1548
Description:
Author: nickcochran
Session Name: BE2C-Candidates-6-9-17
Genome Assembly: hg19
Creation Date: 2017-06-09
Views: 1658
1496995200 1658
Description:
Author: ezra abramms
Session Name: nebulin bam site two
Genome Assembly: mm10
Creation Date: 2017-06-05
Views: 1814
1496649600 1814
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp, Mouse, Chicken, Zebrafish
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1598
1507622400 1598
Description:
Author: peijinlim
Session Name: mm9 Nrf2 ChIPseq Mrp2
Genome Assembly: mm9
Creation Date: 2017-06-01
Views: 1684
1496304000 1684
Description:
Author: yang1221720
Session Name: KDM3A_splicing
Genome Assembly: hg38
Creation Date: 2018-11-22
Views: 1404
1542873600 1404
Description:
Author: ifollon
Session Name: hg19_sangre2
Genome Assembly: hg19
Creation Date: 2017-05-30
Views: 1749
1496131200 1749
Description:
Author: jwrows2014
Session Name: EPAS1 search 5272017
Genome Assembly: hg38
Creation Date: 2017-05-27
Views: 1605
1495872000 1605
Description: This session uses a new format called type=longTabix, here is a mailing list describing this type: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ This new type uses a custom track that points to a .gz file, and where that is located there is also a .gz.tbi file that provides the index. The tab-separated .gz file has contents like the following: chr19 44116910 44119168 chr21:47876840-47878656,2 31515 . The .tbi file is built using the tabix software from: http://samtools.sourceforge.net/tabix.shtml
Author: brianlee
Session Name: hg19.other_regions
Genome Assembly: hg19
Creation Date: 2017-05-25
Views: 1702
1495699200 1702
Description:
Author: Fadak Alali
Session Name: Fall19 Yeast test FA
Genome Assembly: sacCer3
Creation Date: 2019-08-31
Views: 1278
1567238400 1278
Description:
Author: ephong0305
Session Name: GeM MOA HD GWAS.v9
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 1342
1570176000 1342
Description:
Author: Bowen
Session Name: hg38_HBB_rs334
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1329
1571904000 1329
Description:
Author: anneabraham1
Session Name: MAPT mutant alleles Anne Abraham
Genome Assembly: hg38
Creation Date: 2018-02-12
Views: 1571
1518422400 1571
Description:
Author: XiangChen
Session Name: Bio481 Chen AMD SNPs rs67538026
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 2181
1509436800 2181
Description:
Author: heathhm
Session Name: FALL19 Yeast test HMH
Genome Assembly: sacCer3
Creation Date: 2019-08-30
Views: 1419
1567152000 1419
Description:
Author: farshad
Session Name: BRCA_hg19_H3K27Ac_related_profiles20170517
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 1852
1495008000 1852
Description:
Author: ekrobins
Session Name: TSS_CAGE
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 2206
1495008000 2206
Description:
Author: nbosch
Session Name: CRIM1
Genome Assembly: hg19
Creation Date: 2017-05-15
Views: 1672
1494835200 1672
Description:
Author: brianlee
Session Name: hg38.refSeq.UCSC
Genome Assembly: hg38
Creation Date: 2017-05-12
Views: 1833
1494576000 1833
Description:
Author: Francesco_Ferrari
Session Name: rs7599312_SNP
Genome Assembly: hg19
Creation Date: 2017-10-17
Views: 1551
1508227200 1551
Description:
Author: sajjeev
Session Name: progeria_JB
Genome Assembly: mm10
Creation Date: 2019-05-23
Views: 1772
1558598400 1772
Description:
Author: suestring
Session Name: example_DCdiffCA
Genome Assembly: hub_432097_DC
Creation Date: 2019-05-22
Views: 1432
1558512000 1432
Description:
Author: suestring
Session Name: hub_432097_ZebraFish
Genome Assembly: hub_432097_ZebraFish
Creation Date: 2019-05-28
Views: 2179
1559030400 2179
Description: Main overview of the ARID1a gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: arid1a_home
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 537
1660896000 537
Description:
Author: cocopow
Session Name: hg38_primates
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1373
1557388800 1373
Description:
Author: russiandash
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-05-13
Views: 3963
1557734400 3963
Description:
Author: DearDanielxd
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-04-25
Views: 1694
1493107200 1694
Description:
Author: yayinano
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-04-21
Views: 1915
1492761600 1915
Description:
Author: linzho
Session Name: Zoltan_SA3_chip_data
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1338
1557907200 1338
Description:
Author: swarnaseetha
Session Name: TET5hmcTriplicates
Genome Assembly: mm10
Creation Date: 2019-10-08
Views: 1335
1570521600 1335
Description:
Author: [email protected]
Session Name: hg19_GJB2
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1363
1557907200 1363
Description:
Author: [email protected]
Session Name: hg19_SLC26A4
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1335
1557907200 1335
Description:
Author: sayloren
Session Name: hg19-chr12-probes
Genome Assembly: hg19
Creation Date: 2017-04-07
Views: 1804
1491552000 1804
Description:
Author: GDJ_Duke
Session Name: SJC_BAC_Lib_GDJ_PER1_BAC
Genome Assembly: hg38
Creation Date: 2018-09-06
Views: 1555
1536220800 1555
Description:
Author: liyq
Session Name: mm10_2016
Genome Assembly: mm10
Creation Date: 2017-03-18
Views: 1651
1489824000 1651
Description:
Author: PublicSessions
Session Name: N-masked regions on the Y chromosome for hg38
Genome Assembly: hg38
Creation Date: 2017-03-14
Views: 1835
1489478400 1835
Description:
Author: gartnerj928
Session Name: Devi_methyl_IP_tracks
Genome Assembly: mm10
Creation Date: 2017-03-13
Views: 2389
1489392000 2389
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1740
1489132800 1740
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2053
1489132800 2053
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1668
1489132800 1668
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1640
1489132800 1640
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1683
1489132800 1683
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1664
1489132800 1664
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1727
1489132800 1727
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1676
1489132800 1676
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1856
1489132800 1856
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1657
1489132800 1657
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1662
1489132800 1662
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1595
1489132800 1595
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1638
1489132800 1638
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1658
1489132800 1658
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1696
1489132800 1696
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1673
1489132800 1673
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1617
1489132800 1617
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1682
1489132800 1682
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1616
1489132800 1616
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1625
1489132800 1625
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1778
1489132800 1778
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1616
1489132800 1616
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1657
1489132800 1657
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1767
1489132800 1767
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1628
1489132800 1628
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1796
1489132800 1796
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1680
1489132800 1680
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1667
1489132800 1667
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1595
1489132800 1595
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1587
1489132800 1587
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1646
1489132800 1646
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1635
1489132800 1635
Description:
Author: xulab
Session Name: tps_E14_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1679
1489132800 1679
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1753
1489132800 1753
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1598
1489132800 1598
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1855
1489132800 1855
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1778
1489132800 1778
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1728
1489132800 1728
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1576
1489132800 1576
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2037
1489132800 2037
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1734
1489132800 1734
Description:
Author: xulab
Session Name: tps_ALL_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1845
1489132800 1845
Description:
Author: xulab
Session Name: tps_P0_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1678
1489132800 1678
Description:
Author: xulab
Session Name: tps_E16_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1634
1489132800 1634
Description:
Author: xulab
Session Name: tps_E15_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1642
1489132800 1642
Description:
Author: xulab
Session Name: tps_E14_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1644
1489132800 1644
Description:
Author: xulab
Session Name: tps_ALL_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2378
1489132800 2378
Description:
Author: ccornwel
Session Name: cfac
Genome Assembly: canFam3
Creation Date: 2016-09-26
Views: 1719
1474876800 1719
Description:
Author: cocopow
Session Name: hg19-17q12
Genome Assembly: hg19
Creation Date: 2019-01-03
Views: 1523
1546502400 1523
Description:
Author: rtmag4
Session Name: HCT116_ATAC_SEQ_TBLAB
Genome Assembly: hg38
Creation Date: 2017-03-03
Views: 1780
1488528000 1780
Description:
Author: xulab
Session Name: tps_P0_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2047
1489132800 2047
Description: Comparison of 7 primate genomes to the 2nd human chromosome.
Author: l.g.altizer
Session Name: 7Primate_Genomes
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 57
1726560000 57
Description: Synteny and Conservation between Chimp and Human
Author: ALLDEREP
Session Name: Synteny and Conservation
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 46
1726560000 46
Description:
Author: adriennelovett
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 1696
1487923200 1696
Description:
Author: estercastillo
Session Name: AnaBelen_USalamanca_TP53
Genome Assembly: hg19
Creation Date: 2018-05-02
Views: 1705
1525248000 1705
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_final_H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-02-17
Views: 1677
1487318400 1677
Description:
Author: jberus
Session Name: Bio2010-JB
Genome Assembly: hg18
Creation Date: 2017-02-16
Views: 1649
1487232000 1649
Description:
Author: SB
Session Name: hg38_ALK E20 Cas9
Genome Assembly: hg38
Creation Date: 2017-02-15
Views: 1794
1487145600 1794
Description: We have recently released a file type called "longTabix" which supports inter & intra-chromosomal interactions by drawing an "arc" among paired regions in the UCSC Genome Browser. Note the first track at the top of the display, you can click on any of the "arcs" or interaction connections to see details such as ID and score. Credit goes to Cath Tyner for the creation of this session. Link to the original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ
Author: PublicSessions
Session Name: Viewing inter- & intra-chromosomal interactions
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1589
1486972800 1589
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED
Genome Assembly: hg19
Creation Date: 2017-02-10
Views: 1598
1486713600 1598
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED_autoscaled
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1643
1486972800 1643
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_days_5_20_35_40
Genome Assembly: hg19
Creation Date: 2017-02-01
Views: 1645
1485936000 1645
Description:
Author: thomas.sparks
Session Name: 181227-atac1-encode_dnase
Genome Assembly: mm10
Creation Date: 2018-12-27
Views: 1441
1545897600 1441
Description:
Author: xrdong10
Session Name: hg19_fdek
Genome Assembly: hg19
Creation Date: 2017-01-24
Views: 1725
1485244800 1725
Description:
Author: rikrdo89
Session Name: rna-seq cardiac
Genome Assembly: mm9
Creation Date: 2017-01-24
Views: 1692
1485244800 1692
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1621
1485158400 1621
Description:
Author: ryansamuel13
Session Name: TAS2R28 Gene
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1685
1485158400 1685
Description:
Author: Shockwing
Session Name: South, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1643
1484553600 1643
Description:
Author: ryansamuel13
Session Name: Samuel, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1584
1484553600 1584
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test ALA
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1553
1515398400 1553
Description:
Author: harri5al
Session Name: Spring18 Yeast Test (AH)
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1630
1515398400 1630
Description:
Author: keitermd
Session Name: Spring17_Correct MOUSE TEST - MDK
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1825
1483948800 1825
Description:
Author: khan2sa
Session Name: Spring17 Mouse test (SK)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1929
1483948800 1929
Description:
Author: ryansamuel13
Session Name: Spring17 Worm test (RMS)
Genome Assembly: ce11
Creation Date: 2017-01-09
Views: 1633
1483948800 1633
Description:
Author: keitermd
Session Name: Spring17 MOUSE TEST - MDK
Genome Assembly: mm10
Creation Date: 2017-01-09
Views: 1627
1483948800 1627
Description:
Author: lesevimx
Session Name: Spring17 Mouse test (ML)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1601
1483948800 1601
Description:
Author: idror
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-01-03
Views: 1846
1483430400 1846
Description:
Author: yuelab
Session Name: mm9_min
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1698
1484553600 1698
Description:
Author: warrenac
Session Name: GIT-mQTL-ASM
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 2065
1475568000 2065
Description:
Author: jkearns94
Session Name: Fall 16 481 Final JK
Genome Assembly: mm9
Creation Date: 2016-12-12
Views: 1764
1481529600 1764
Description:
Author: nightfury
Session Name: mm9-fam60a-de
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 1803
1481443200 1803
Description: Since the reference genome assembly is a series of clone sequences from multiple individuals, and all individuals contain rare alleles, some of these rare alleles are included in reference assemblies. In this case, NM_001103170 (TGc), "c" mismatches the reference assemblies "A" because the reference sequence contains a substitution at this location. Please note that this example is on hg18, many (but not all) of these cases have been addressed in newer assemblies. AADACL3, in particular, does not have this substitution in GRCh38/hg38. Credit goes to Christopher Villarreal for creation of this session. Link to original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/6TG1Pze9rUI/TLsKg7bNAwAJ
Author: PublicSessions
Session Name: hg18.AADACL3_mRNA_discrepancy_vs_reference
Genome Assembly: hg18
Creation Date: 2016-12-09
Views: 1676
1481270400 1676
Description:
Author: yezheng
Session Name: ATAC-seq_mm9_WT-+MU-+
Genome Assembly: mm9
Creation Date: 2019-01-31
Views: 1381
1548921600 1381
Description:
Author: labrozam
Session Name: Labrozzi, Fall 17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-01
Views: 1524
1506844800 1524
Description:
Author: cocopow
Session Name: hg19_bigBed12
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1363
1553155200 1363
Description:
Author: suestring
Session Name: ???
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1327
1552032000 1327
Description:
Author: suestring
Session Name: NotFusion
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1392
1552032000 1392
Description:
Author: suestring
Session Name: 2
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1465
1552032000 1465
Description:
Author: suestring
Session Name: 1
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1422
1552032000 1422
Description:
Author: arem
Session Name: hg19 fin
Genome Assembly: hg19
Creation Date: 2019-02-21
Views: 1655
1550736000 1655
Description:
Author: sureshpsbio
Session Name: mm10_Chip fam40
Genome Assembly: mm10
Creation Date: 2019-02-20
Views: 1806
1550649600 1806
Description:
Author: ruhollah
Session Name: hg19_1600_chr1_nmt=20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1350
1550649600 1350
Description:
Author: ruhollah
Session Name: hg19_844_chr7_nmt20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1310
1550649600 1310
Description:
Author: ruhollah
Session Name: hg19_412Chr8_nmt19
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1919
1550649600 1919
Description:
Author: ruhollah
Session Name: hg19_1148_chr1_nmt18
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1385
1550649600 1385
Description:
Author: liaohy
Session Name: RNAseq_Liu.DY_AM20181126-13
Genome Assembly: mm10
Creation Date: 2019-12-31
Views: 1199
1577779200 1199
Description:
Author: ruhollah
Session Name: hg19_986_chr3_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1449
1554105600 1449
Description:
Author: ruhollah
Session Name: hg19_1305_chr16_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1321
1554105600 1321
Description:
Author: ruhollah
Session Name: hg19_1388_chr1_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1568
1554105600 1568
Description:
Author: ruhollah
Session Name: hg19_1136_chr17_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1346
1554105600 1346
Description:
Author: ruhollah
Session Name: hg19_1373_chr19_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1332
1554105600 1332
Description:
Author: ruhollah
Session Name: hg19_1044_chr2_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1394
1554105600 1394
Description:
Author: ruhollah
Session Name: hg19_128_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1328
1554105600 1328
Description:
Author: ruhollah
Session Name: hg19_511_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1545
1554105600 1545
Description:
Author: ruhollah
Session Name: hg19_1111_chr9_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1384
1554105600 1384
Description:
Author: ruhollah
Session Name: hg19_237_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1602
1554105600 1602
Description:
Author: ruhollah
Session Name: hg19_1327_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1535
1554105600 1535
Description:
Author: ruhollah
Session Name: hg19_40_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1602
1554105600 1602
Description:
Author: ruhollah
Session Name: hg19_954_chr1_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1374
1554105600 1374
Description:
Author: ruhollah
Session Name: hg19_1129_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1516
1554105600 1516
Description:
Author: ruhollah
Session Name: hg19_960_chrX_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1472
1554105600 1472
Description:
Author: ruhollah
Session Name: hg19_662_chr6_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1302
1554105600 1302
Description:
Author: ruhollah
Session Name: hg19_876_chr17_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1329
1554105600 1329
Description:
Author: ruhollah
Session Name: hg19_149_chr1_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1340
1554105600 1340
Description:
Author: bashamal
Session Name: basham hg38 assignment 10/10
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1656
1507536000 1656
Description:
Author: [email protected]
Session Name: mm10 celltype NTRK2
Genome Assembly: mm10
Creation Date: 2018-12-04
Views: 759
1543910400 759
Screenshot not available
Click Here to view
Description:
Author: Tao Zhang
Session Name: chicken transcriptome
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-29
Views: 2304
1480406400 2304
Description:
Author: chkcole
Session Name: TN5_Prime_Alignments
Genome Assembly: hg38
Creation Date: 2017-10-24
Views: 2063
1508832000 2063
Screenshot not available
Click Here to view
Description:
Author: maria pia miano
Session Name: hg19s
Genome Assembly: hg19
Creation Date: 2016-11-16
Views: 1856
1479283200 1856
Description:
Author: jtm
Session Name: shiny_app_mm10_v2
Genome Assembly: mm10
Creation Date: 2018-11-05
Views: 1687
1541404800 1687
Description:
Author: headricn
Session Name: Fall16 481 final CH
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 1735
1481443200 1735
Screenshot not available
Click Here to view
Description:
Author: Courtney Stout
Session Name: AMD hg38 APOE SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1745
1478246400 1745
Screenshot not available
Click Here to view
Description:
Author: Courtney Stout
Session Name: hg38 AMD CNN2 SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1764
1478246400 1764
Screenshot not available
Click Here to view
Description:
Author: Courtney Stout
Session Name: hg38 AMD APOE SNP(CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1841
1478246400 1841
Screenshot not available
Click Here to view
Description:
Author: Courtney Stout
Session Name: hg38 AMD SNPs
Genome Assembly: hg38
Creation Date: 2016-10-27
Views: 1779
1477555200 1779
Description: This session highlights the differences in microRNA expression between endothelial cells and other primary cells types. The data in this session comes from the "Towards the human cellular microRNAome" public hub, created by Marc Halushka and Arun Patil at the Johns Hopkins Medical Institute.
Author: chmalee
Session Name: hg38_microRNA_cell_expression
Genome Assembly: hg38
Creation Date: 2017-09-11
Views: 2862
1505116800 2862
Description:
Author: [email protected]
Session Name: MMR-branchpoints-260318
Genome Assembly: hg19
Creation Date: 2018-03-26
Views: 1608
1522051200 1608
Description:
Author: rmaus
Session Name: nha_PE
Genome Assembly: mm8
Creation Date: 2016-10-18
Views: 1797
1476777600 1797
Description:
Author: Sega666
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-19
Views: 1665
1476864000 1665
Description:
Author: cath
Session Name: v339publicSessionTest
Genome Assembly: hg38
Creation Date: 2016-10-04
Views: 2088
1475568000 2088
Screenshot not available
Click Here to view
Description:
Author: Isilver1
Session Name: PCBP2_CLIP-seq_Reps1-3
Genome Assembly: mm10
Creation Date: 2017-03-28
Views: 1841
1490688000 1841
Description:
Author: Sega666
Session Name: 02.11
Genome Assembly: hg19
Creation Date: 2016-11-02
Views: 1751
1478073600 1751
Description:
Author: artman1967
Session Name: hg19_ATAC_2019
Genome Assembly: hg19
Creation Date: 2019-03-28
Views: 1437
1553760000 1437
Description:
Author: mirigitik
Session Name: bahcc1
Genome Assembly: mm9
Creation Date: 2016-05-16
Views: 2151
1463385600 2151
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech
Genome Assembly: hg19
Creation Date: 2016-09-14
Views: 1799
1473840000 1799
Description:
Author: zxtzhangqian
Session Name: 3a-tet2
Genome Assembly: mm9
Creation Date: 2016-09-14
Views: 1733
1473840000 1733
Description:
Author: vivekgopalanmedgenome
Session Name: hg19_panel_design_JRK
Genome Assembly: hg19
Creation Date: 2016-09-11
Views: 1789
1473580800 1789
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech GenneReader
Genome Assembly: hg19
Creation Date: 2016-09-16
Views: 1726
1474012800 1726
Description:
Author: sushivision
Session Name: TKNK31-090116
Genome Assembly: mm9
Creation Date: 2016-09-02
Views: 1659
1472803200 1659
Screenshot not available
Click Here to view
Description:
Author: [email protected]
Session Name: C2H2_type_1
Genome Assembly: hg19
Creation Date: 2016-09-01
Views: 1745
1472716800 1745
Description:
Author: sambuca_shot
Session Name: mouse_reprog
Genome Assembly: mm10
Creation Date: 2016-03-23
Views: 1796
1458720000 1796
Description: GTEx Allele Specific Expression hub from the Lappalainen Lab at the New York Genome Center. This session shows a region along chromosome 17 of high skin-specific allelic imbalance in a large number of Keratin genes.
Author: chmalee
Session Name: hg19KeratinAse
Genome Assembly: hg19
Creation Date: 2016-08-30
Views: 2758
1472544000 2758
Description:
Author: pfiziev
Session Name: t_cell_development.H3K4me2 DECSTEP
Genome Assembly: mm9
Creation Date: 2016-08-26
Views: 2043
1472198400 2043
Description:
Author: ps
Session Name: hg19.newTargets
Genome Assembly: hg19
Creation Date: 2016-08-26
Views: 1827
1472198400 1827
Description: We sequenced the hermaphroditic freshwater snail, Biomphalaria glabrata (strain BB02), the host for the medically important trematode parasite, Schistosoma mansoni, using 1X coverage from plasmids and 0.1X BAC end sequencing on the ABI3730xl and 10X coverage sequenced on the Roche 454 Sequencer (including 2 paired end read runs) was initially assembled with Newbler. The Newbler assembly was screened for contamination then merged with a Soap assembly of Illumina reads followed by use of an in-house program for collapsing of redundant heterozygous contigs. Next, we applied our program, GapCloser, which closes gaps in the assembly by making iterative joins using Illumina reads. Finally we removed contigs less than 200 bases and incorporated reads into the assembly that had been assembled in a prior version of the Newbler assembly but were not assembled in this round. The resulting assembly, going by the name of assembly version 4.3, is 898.9Mb bases with an N50 contig length of 6.9kb and N50 scaffold length of 42kb. For creation of the linkage group AGP files, we identified all scaffolds that were uniquely placed on a single linkage group. Because of low marker density, only 145Mb was localized to specific linkage groups and scaffolds could not be ordered and oriented within linkage groups. Therefore, the scaffolds were simply placed in the order suggested by the linkage mapping on *_random for each linkage group. Credits: B. glabrata BB02 samples - Omar dos Santos Carvalho, Centro de Pesquisas Rene Rachou-Fiocruz (sample location: Barreiro, Brazil) BAC library - Coen M. Adema et al. (2006) Sequencing and Assembly - The Genome Institute, Washington University School of Medicine Linkage map - Jacob Tennessen and Michael Blouin, Oregon State University White Paper - Matty Knight et al (2003) Others - - Fred Lewis Biomedical Research Institute of the American Foundation of Biomedical Research - Eric Loker University of New Mexico Biology - Nithya Raghavan Biomedical Research Institute of the American Foundation of Biomedical Research
Author: lijing
Session Name: hub_107761_bioGla0
Genome Assembly: hub_107761_bioGla0
Creation Date: 2016-08-24
Views: 1885
1472025600 1885
Description:
Author: elinshiao
Session Name: HEK293T_all
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1369
1599465600 1369
Description:
Author: mperelis
Session Name: Stein_PDX1
Genome Assembly: mm10
Creation Date: 2016-09-30
Views: 1912
1475222400 1912
Description:
Author: treparriscos
Session Name: Sara_poised_enhancers_1xnorm_mm10_2
Genome Assembly: mm10
Creation Date: 2016-06-03
Views: 1307
1464940800 1307
Description:
Author: sappingtonae
Session Name: test
Genome Assembly: hg38
Creation Date: 2016-08-15
Views: 1947
1471248000 1947
Description:
Author: yezheng
Session Name: ATAC-seq_mm9
Genome Assembly: mm9
Creation Date: 2018-01-22
Views: 2046
1516608000 2046
Description:
Author: [email protected]
Session Name: Lidral, hg19, CL/P GWAS intervals
Genome Assembly: hg19
Creation Date: 2014-09-18
Views: 1577
1411027200 1577
Description:
Author: shiguoming
Session Name: mm9_160812
Genome Assembly: mm9
Creation Date: 2016-08-11
Views: 1325
1470902400 1325
Description:
Author: ykumar84
Session Name: mm10_Oct4
Genome Assembly: mm10
Creation Date: 2019-07-22
Views: 1560
1563782400 1560
Description: This is an assembly hub for the AgamP4 assembly of Anopheles gambiae PEST strain. It includes the assembly; the coding genes and pseudogenes from vectorbase version 4.3; predicted stop codon readthrough regions; PhyloCSF tracks showing evolutionary protein-coding potential; splice-prediction tracks using the maximum-entropy splice-prediction algorithm; and novel coding and pseudogene predictions using PhyloCSF, excluding regions already annotated in vectorbase version 4.3.
Author: iljungr
Session Name: AgamP4
Genome Assembly: hub_102577_AgamP4
Creation Date: 2016-08-09
Views: 2313
1470729600 2313
Description:
Author: brianlee
Session Name: mm9.RP23.470O14
Genome Assembly: mm9
Creation Date: 2016-08-03
Views: 1554
1470211200 1554
Description:
Author: cocopow
Session Name: hub_1567195_araTha1_remap
Genome Assembly: hub_1567195_araTha1
Creation Date: 2019-09-04
Views: 1663
1567584000 1663
Description:
Author: QAtester3
Session Name: ce11_ENCODE_hub
Genome Assembly: ce11
Creation Date: 2018-02-08
Views: 1469
1518076800 1469
Description:
Author: QAtester3
Session Name: !@!$(GSDFG
Genome Assembly: galGal6
Creation Date: 2019-01-22
Views: 1477
1548144000 1477
Description: This session of gene prediction tracks for "heart genes" uses the interact and bigGenePred formats to create decorations and the image of a heart. Read more about the interact format and bigGenePred formats from links on the Data File Formats help page under the Help menu and FAQs: http://genome.ucsc.edu/FAQ/FAQformat.html
Author: PublicSessions
Session Name: heart
Genome Assembly: hg38
Creation Date: 2019-02-11
Views: 4115
1549872000 4115
Description:
Author: PublicSessions
Session Name: Tabula_muris
Genome Assembly: mm10
Creation Date: 2019-04-05
Views: 1463
1554451200 1463
Description:
Author: cook2wj
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-22
Views: 1734
1469174400 1734
Description:
Author: matthew.law
Session Name: MTAP_melanoma
Genome Assembly: hg19
Creation Date: 2016-07-25
Views: 1833
1469433600 1833
Description:
Author: lesevimx
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-21
Views: 1772
1469088000 1772
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP primers test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 2026
1469088000 2026
Description:
Author: hadani81
Session Name: CGEMS Mouse HD/MC/JD Test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1648
1469088000 1648
Description:
Author: Nithesh
Session Name: CGEMS Yeast NPC test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1732
1469088000 1732
Description:
Author: monroejd
Session Name: CGEMS Yeast JM
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1688
1469088000 1688
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1703
1469088000 1703
Description:
Author: kapsakcj
Session Name: CGEMS Mouse CK test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1654
1469088000 1654
Description:
Author: Shockwing
Session Name: CGEMS Yeast (Shockwing) Test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1894
1469088000 1894
Description:
Author: herrsp
Session Name: CGEMS Yeast SPH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1712
1469088000 1712
Description:
Author: blossta
Session Name: CGEMS Worm TB test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1731
1469088000 1731
Description:
Author: shufengliu
Session Name: CGEMS Human SL test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1949
1469088000 1949
Description:
Author: klj002
Session Name: CGEMS Worm (KLJ SFB) test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1701
1469088000 1701
Description:
Author: MaxHenderson
Session Name: CGEMS Yeast MEH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1763
1469088000 1763
Description:
Author: cook2wj
Session Name: CGEMS Human WCSK test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1642
1469088000 1642
Description:
Author: bravonja
Session Name: CGEMS Human JBSP test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1714
1469088000 1714
Description:
Author: stjacqrm
Session Name: CGEMS Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1720
1469088000 1720
Description:
Author: s.jurg96
Session Name: CGEMS worm SJ EA CG test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1672
1469088000 1672
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY Custom Tracks Chr6
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1752
1469088000 1752
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1928
1469088000 1928
Description:
Author: youngbh
Session Name: CGEMS Human BHY test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1805
1469088000 1805
Description:
Author: youngbh
Session Name: CGEMS Worm BHY test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1679
1469088000 1679
Description:
Author: dtautz
Session Name: wildmouse
Genome Assembly: mm10
Creation Date: 2016-07-26
Views: 2584
1469520000 2584
Description:
Author: youngbh
Session Name: CGEMS Yeast BHY test
Genome Assembly: sacCer3
Creation Date: 2016-07-20
Views: 1739
1469001600 1739
Description:
Author: arem
Session Name: colon methylation
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1412
1551859200 1412
Screenshot not available
Click Here to view
Description:
Author: Courtney Stout
Session Name: CGems Yeast AH test
Genome Assembly: sacCer3
Creation Date: 2016-07-19
Views: 1762
1468915200 1762
Description:
Author: MWVermunt
Session Name: H3K27ac Human Brain, Vermunt et al (2014) Cell Reports
Genome Assembly: hg19
Creation Date: 2016-07-13
Views: 1998
1468396800 1998
Description:
Author: pliu
Session Name: PRAM_master_set
Genome Assembly: hg38
Creation Date: 2019-01-04
Views: 1692
1546588800 1692
Description:
Author: sajjeev
Session Name: comic sj15_22
Genome Assembly: hg19
Creation Date: 2019-01-04
Views: 1474
1546588800 1474
Description:
Author: lijin
Session Name: session7 97L 3 chip
Genome Assembly: hg19
Creation Date: 2016-06-20
Views: 1992
1466409600 1992
Description: This session displays the locations of significant SNPs from the GWAS for breast cancer DFS with P < 1 x 10-5 and eQTL-SNPs from GTEx portal with P < 1 × 10–10.
Author: Wen-Cheng
Session Name: rs1024176
Genome Assembly: hg19
Creation Date: 2018-05-25
Views: 1420
1527235200 1420
Description: This session demonstrates the GTEx track on the human assembly hg19. The GTEx track shows data from the NIH Genotype-Tissue Expression project and displays expression data for each gene, based on GENCODE gene models, from 51 tissues collected from 570 individual. This session also demonstrates the gene-only mode of the multi-region feature, which removes intergenic regions from the display.
Author: mspeir
Session Name: hg19_gtexAnnouncement
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 1833
1466150400 1833
Description: This session is demonstrating the exon-only mode of the multi-region feature. The exon-only mode uses the GENCODE v22 track to slice up the normal display and remove both intronic and intergenic regions from the display. Only those regions covered by exons, both coding and noncoding, are left in the display. For more on the multi-region display see the user guide: http://genome.ucsc.edu/goldenPath/help/multiRegionHelp.html.
Author: mspeir
Session Name: hg38_exonOnlyExample
Genome Assembly: hg38
Creation Date: 2016-06-17
Views: 1733
1466150400 1733
Description:
Author: mspeir
Session Name: hg19_CAGrepeat
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 1800
1466150400 1800
Description: Public session showcasing the GTEx gene expression track and GTEx RNA-seq signal hub for the <a target=_blank href='http://genome.ucsc.edu/blog/gtex-resources-in-the-browser/'>GTEx Resources in the Browser</a> GB blog article. The session shows a genomic region with 5 genes with different patterns of tissue-specific expression.
Author: kate
Session Name: GTEx demo for blog (long, with error)
Genome Assembly: hg19
Creation Date: 2016-06-09
Views: 3929
1465459200 3929
Description:
Author: ruhollah
Session Name: hg19_681_chr15_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1505
1554105600 1505
Description: Session highlights a mouse-specific repeat on chromosome 12. You can see the gap in the 60-way vertebrate alignment surrounding the repeat, which is highlighted in light blue. The repeat is classified as a LINE and is part of the L1 family of repeats. Additionally, on the far right-hand side of the display, you can see the retrotransposed Bf3 gene.
Author: mspeir
Session Name: mm10_MouseSpecificRepeat_plus_RetroposedGene
Genome Assembly: mm10
Creation Date: 2016-05-24
Views: 1619
1464076800 1619
Description: Session displays the promoter region of DARC on human assembly hg19 including UCSC Genes, dbSNP 146 (Common subset) and the Publications track showing sequences and SNPs text-mined from PubMed Central and Elsevier. Adapted from Figure 1 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig1
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 1795
1464076800 1795
Description: Session displays the dyskeratosis congenita 1 (DKC1) gene using the exon-only multi-region mode in the human assembly hg38. Alongside the gene structure, tracks displaying dbSNP "flagged" variants, OMIM clinical variants, ENCODE transcription levels from 9 cell lines, a 100-way vertebrate alignment (only a subset of species displayed), and conservation scores calculated using phyloP across this 100-way alignment.
Author: mspeir
Session Name: hg38_DKC1_SNPs_Cons_Transcription
Genome Assembly: hg38
Creation Date: 2016-05-24
Views: 1734
1464076800 1734
Description: Session displays the promoter region and transcription start of IRF1 on human assembly hg19 showing UCSC Genes, 1000 Genomes Phase 3 Integrated Variant Calls in the haplotype sorting VCF display mode, histone mark H3K27Ac binding in overlays of 7 ENCODE cell lines and PhyloP conservation scores from alignments of 100 vertebrates. Adapted from Figure 2 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig2
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 1862
1464076800 1862
Description:
Author: as00419
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1394
1557388800 1394
Description:
Author: lijin
Session Name: session2 four types
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 2424
1460880000 2424
Description:
Author: lijin
Session Name: session5 whole genome methy
Genome Assembly: hg19
Creation Date: 2016-04-29
Views: 1872
1461916800 1872
Description:
Author: leipinji
Session Name: hg19-HCT116-liyiming
Genome Assembly: hg19
Creation Date: 2016-04-12
Views: 1591
1460448000 1591
Description:
Author: Julia H-Z
Session Name: Cancer Cell Tracks
Genome Assembly: hg19
Creation Date: 2019-02-19
Views: 1440
1550563200 1440
Description:
Author: Julia H-Z
Session Name: CC Tracks 2
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1394
1550649600 1394
Description:
Author: jdf228
Session Name: PGC-1 alpha ChIP-seq C2C12
Genome Assembly: mm9
Creation Date: 2017-03-20
Views: 1876
1489996800 1876
Description:
Author: gunasekaran
Session Name: Gunasekaran_Dhandapani_UCSC_mm10
Genome Assembly: mm10
Creation Date: 2019-02-07
Views: 1336
1549526400 1336
Description:
Author: ascendgene
Session Name: 60genes panel chr1
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1698
1532505600 1698
Description:
Author: peijinlim
Session Name: mm9 nrf2chipseq tracks
Genome Assembly: mm9
Creation Date: 2016-10-19
Views: 1769
1476864000 1769
Description:
Author: SCRB20
Session Name: SCRB20_GOOD
Genome Assembly: hg19
Creation Date: 2016-03-21
Views: 1615
1458547200 1615
Description:
Author: msantos.13
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-06
Views: 1382
1549440000 1382
Description:
Author: janzop
Session Name: mm9_HBx-RFP
Genome Assembly: mm9
Creation Date: 2016-09-27
Views: 1520
1474963200 1520
Description:
Author: lijin
Session Name: session1 Liver 97L exp meth
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 1803
1460880000 1803
Description:
Author: labrozam
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2016-10-02
Views: 2150
1475395200 2150
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp Assignement
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1498
1507622400 1498
Description:
Author: kianoush
Session Name: Panels
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1198
1551859200 1198
Description:
Author: arem
Session Name: hg19_chr10_Human
Genome Assembly: hg19
Creation Date: 2019-03-08
Views: 1348
1552032000 1348
Description:
Author: ephong0305
Session Name: KSG GWAS IA chr1_22 v1
Genome Assembly: hg19
Creation Date: 2021-07-30
Views: 825
1627632000 825
Description:
Author: dunlapea
Session Name: Dunlap, BIO480 Uba1 example
Genome Assembly: hg19
Creation Date: 2016-09-04
Views: 1766
1472976000 1766
Description:
Author: cocopow
Session Name: hg19epigenetics_WASHU_VizHub
Genome Assembly: hg19
Creation Date: 2019-02-07
Views: 1449
1549526400 1449
Description:
Author: harri5al
Session Name: CGEMS yeast (AH) test
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1750
1515398400 1750
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test Abraham
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1562
1515398400 1562
Description:
Author: nedaronaghi
Session Name: hg19-all_weeks
Genome Assembly: hg19
Creation Date: 2017-03-07
Views: 1737
1488873600 1737
Description:
Author: Natedawg34
Session Name: fall17 bio630 human NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1550
1505289600 1550
Description:
Author: Natedawg34
Session Name: Fall 2017 Bio 630 NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1510
1505289600 1510
Description:
Author: stjacqrm
Session Name: Fall17 Bio630 Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2017-09-13
Views: 1528
1505289600 1528
Description:
Author: alexc
Session Name: MitoGenome Analysis
Genome Assembly: hg38
Creation Date: 2016-05-17
Views: 1577
1463472000 1577
Description:
Author: Natedawg34
Session Name: Miller, Fall17, Uba1
Genome Assembly: mm10
Creation Date: 2017-09-12
Views: 1572
1505203200 1572
Description:
Author: alexc
Session Name: ARUP_cyto
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1958
1543219200 1958
Description: chr2
Author: diazacex
Session Name: Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 39
1726560000 39
Description:
Author: leipinji
Session Name: hg19-HCT16-H3K27ac-P53-EP300
Genome Assembly: hg19
Creation Date: 2015-10-22
Views: 1676
1445500800 1676
Description:
Author: hfw824
Session Name: Dou_LADs IgHV
Genome Assembly: hg19
Creation Date: 2015-10-20
Views: 1891
1445328000 1891
Description:
Author: delphine.rolando10
Session Name: hg19_HI-LNCs_UCSCsession
Genome Assembly: hg19
Creation Date: 2016-11-01
Views: 1772
1477987200 1772
Screenshot not available
Click Here to view
Description:
Author: wentao li
Session Name: 2CPD and 64 NT2
Genome Assembly: hg19
Creation Date: 2015-10-06
Views: 1535
1444118400 1535
Description:
Author: leipinji
Session Name: hg19-hct116-LYM-RNASeq
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 1738
1507190400 1738
Description:
Author: lianeslaughter
Session Name: mm9-H4K16acRestored
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 2004
1506412800 2004
Description:
Author: [email protected]
Session Name: evo mels hg19 TFAP2A in hNCC
Genome Assembly: hg19
Creation Date: 2014-05-29
Views: 1297
1401350400 1297
Description:
Author: GenePeeks
Session Name: .2017.10 Haplotype & HGDP
Genome Assembly: hg19
Creation Date: 2017-10-06
Views: 1857
1507276800 1857
Screenshot not available
Click Here to view
Description:
Author: jcasper
Session Name: bedtoolsvssamtools
Genome Assembly: hg18
Creation Date: 2014-05-27
Views: 1734
1401177600 1734
Description:
Author: jverploegen
Session Name: GHE sequencing steroids
Genome Assembly: hg19
Creation Date: 2017-10-10
Views: 1718
1507622400 1718
Description:
Author: hs523
Session Name: mm10-ZFP57-SentToAnastasia-merged
Genome Assembly: mm10
Creation Date: 2016-01-13
Views: 1818
1452672000 1818
Description:
Author: GenePeeks
Session Name: .2017 Zoomed-in View 1
Genome Assembly: hg19
Creation Date: 2017-10-09
Views: 1511
1507536000 1511
Description:
Author: taly
Session Name: EnhancerPrediction
Genome Assembly: dm3
Creation Date: 2017-10-10
Views: 1640
1507622400 1640
Description:
Author: rhead
Session Name: 450k.EPIC.beadchip
Genome Assembly: hg19
Creation Date: 2016-11-06
Views: 1828
1478419200 1828
Description: This mailing question allows one to see how you can color the current DNA with data from tracks such as SNP tracks. Load the session, then type "v d" or go to the View menu and then select DNA.<br> Once you are on the "Get DNA for" page do not click "get DNA" rather click the <b>'extended case/color options'</b> button and get Extended DNA Case/Color Output with DNA colored per the SNP tracks (150 in this case) or choose other tracks. <b>Note</b> that the All SNPs are Italic and Blue and the Common SNPs are Bold and Red and when they are both the colors and style combine.
Author: brianlee
Session Name: hg19.MLQ_20306
Genome Assembly: hg19
Creation Date: 2017-10-11
Views: 1648
1507708800 1648
Description:
Author: [email protected]
Session Name: eliz leslie hg19
Genome Assembly: hg19
Creation Date: 2014-01-17
Views: 1294
1389945600 1294
Description: This is a session with some highlights.
Author: brianlee
Session Name: moreHighlights
Genome Assembly: hg38
Creation Date: 2019-05-07
Views: 1310
1557216000 1310
Description:
Author: josoga2
Session Name: chromHmm
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1219
1591689600 1219
Description: nar
Author: as00419
Session Name: example
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1359
1557388800 1359
Description:
Author: ccpowell
Session Name: 50120_solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-07
Views: 1203
1588838400 1203
Description:
Author: bashamal
Session Name: hg38 chr2 comparison 10/10 in class
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1554
1507622400 1554
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_hotspots_131686
Genome Assembly: hg19
Creation Date: 2017-10-19
Views: 1585
1508400000 1585
Description:
Author: cocopow
Session Name: hg18_44way_bed
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1282
1563955200 1282
Description:
Author: wenzelmk
Session Name: BIO481 Mouse (Wenzel & Zeher) test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1444
1507190400 1444
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1509
1507190400 1509
Description:
Author: herdaj
Session Name: Bio481 Human Herd Test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1673
1507190400 1673
Description:
Author: labrozam
Session Name: Bio481 Human Labrozzi-Grant test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1533
1507190400 1533
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Test
Genome Assembly: sacCer3
Creation Date: 2017-10-05
Views: 1541
1507190400 1541
Description: This session shows the Integrative and Discriminative Epigenome Annotation System (IDEAS) Public Hub, which has data for inferred chromatin states in 127 cell types. A color key for each state is shown near a heatmap on the Track Description page, also found in the related journal <a href="https://academic.oup.com/view-large/figure/97265435/gkx659fig1.jpg/Accurate%20and%20reproducible%20functional%20maps%20in%20127%20human%20cell%20types%20via%202D%20genome%20segmentation">figure 1</a>. This session has some segmentation examples by IDEAS and ChromHMM in HSC and B-cell cell types (9 total) near genes CIITA and CLEC16A. Find more reference information on the Track Description page or at this <a href="https://doi.org/10.1093/nar/gkx659">journal article</a>. The IDEAS algorithm is available on GitHub at <a href="https://github.com/yuzhang123/IDEAS">https://github.com/yuzhang123/IDEAS</a>.
Author: brianlee
Session Name: hg19.IDEAS.hub
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 1958
1507190400 1958
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_Pancreas_131774
Genome Assembly: hg19
Creation Date: 2017-10-22
Views: 1555
1508659200 1555
Description:
Author: hujian5241
Session Name: fly_dh1_dm3_bw
Genome Assembly: dm3
Creation Date: 2017-11-13
Views: 1504
1510560000 1504
Description:
Author: simonwang612
Session Name: Methylation
Genome Assembly: mm10
Creation Date: 2020-07-25
Views: 1617
1595664000 1617
Description:
Author: anneabraham1
Session Name: Abraham, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-13
Views: 1707
1515830400 1707
Description:
Author: [email protected]
Session Name: Ruchi tracks hg19
Genome Assembly: hg19
Creation Date: 2014-01-27
Views: 1322
1390809600 1322
Description:
Author: twx123
Session Name: PTC-mm9-newest
Genome Assembly: mm9
Creation Date: 2015-06-10
Views: 1405
1433923200 1405
Description:
Author: cocopow
Session Name: hg38_chr17_KCNJ18
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1556
1551945600 1556
Description:
Author: [email protected]
Session Name: mm9 visel enhancers
Genome Assembly: mm9
Creation Date: 2014-01-11
Views: 1389
1389427200 1389
Description:
Author: Shirley
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2018-11-20
Views: 1242
1542700800 1242
Description:
Author: QAtester
Session Name: 111hg38
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1781
1545379200 1781
Description:
Author: Boonede
Session Name: MAPT_DougBoone
Genome Assembly: hg38
Creation Date: 2019-03-11
Views: 1387
1552291200 1387
Description:
Author: Guillermo6
Session Name: hg19_ashg2014_SNPs
Genome Assembly: hg19
Creation Date: 2017-11-01
Views: 1678
1509523200 1678
Description:
Author: ferhatay
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-08-25
Views: 1698
1472112000 1698
Description:
Author: kkarri
Session Name: rn6_transcriptome
Genome Assembly: rn6
Creation Date: 2017-10-27
Views: 1655
1509091200 1655
Description:
Author: wangt5
Session Name: HBEC_VitD
Genome Assembly: hg19
Creation Date: 2017-11-15
Views: 1516
1510732800 1516
Description:
Author: bashamal
Session Name: Basham, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1540
1506931200 1540
Description:
Author: cocapo
Session Name: ponAbe3_BTN1A1
Genome Assembly: ponAbe3
Creation Date: 2018-11-15
Views: 1641
1542268800 1641
Description:
Author: lbenner
Session Name: Sxl
Genome Assembly: dm6
Creation Date: 2016-10-22
Views: 1926
1477123200 1926
Description:
Author: macdonem
Session Name: Old AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1540
1509436800 1540
Description:
Author: macdonem
Session Name: New AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1552
1509436800 1552
Description:
Author: falbert
Session Name: FP_sacCer3
Genome Assembly: sacCer3
Creation Date: 2013-08-07
Views: 1550
1375862400 1550
Description:
Author: ruhollah
Session Name: hg19_94Chr12_28
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1549
1543219200 1549
Description: EEPD1 ChIP-seq on chromosome 1 hg38
Author: abacolla
Session Name: eepd1_chr1
Genome Assembly: hg38
Creation Date: 2023-05-30
Views: 344
1685433600 344
Description:
Author: cocopow
Session Name: hg38_ RepeatMasker
Genome Assembly: hg38
Creation Date: 2019-01-24
Views: 1484
1548316800 1484
Description:
Author: kkaczor
Session Name: cirm_ucla
Genome Assembly: hg38
Creation Date: 2020-11-12
Views: 1122
1605168000 1122
Description:
Author: cocopow
Session Name: hg38_tf _pc
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1313
1560240000 1313
Description:
Author: cocopow
Session Name: hg38_tf_pc2
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1265
1560240000 1265
Description:
Author: cocopow
Session Name: hg19_myc+ctcf
Genome Assembly: hg19
Creation Date: 2019-06-11
Views: 1448
1560240000 1448
Description:
Author: cocopow
Session Name: hg38_myc+ctcf
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1458
1560240000 1458
Description:
Author: dtautz
Session Name: wildmouse-introgression
Genome Assembly: mm10
Creation Date: 2017-11-04
Views: 1620
1509782400 1620
Description:
Author: lijin
Session Name: session4 plus h3k27ac density andpeaks
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 1743
1461830400 1743
Description:
Author: lijin
Session Name: session3 plus h3k27ac
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 1776
1461830400 1776
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1641
1508227200 1641
Description:
Author: XiangChen
Session Name: Bio481 Chen Gzmm CBRs in Mice Photoreceptors
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1494
1510905600 1494
Description: This session illustrates how a user was having a hard time aligning the cDNA sequence with their Predicted Protein. They were manually using DNA sequence to make a triplet number to figure out codon numbering. The session shows how when zoomed in on the base level, if you right click the top Base Position track and set it to display in "full" you will see predicted proteins for every set of codons across the genome. This particular session at the start of the SIRT1 gene is also displaying the conservation tracks with similar coding information for several species. This information is also available in the table browser, where you can select output as "sequence" for a genomic region when you select a gene's track table as the source.
Author: brianlee
Session Name: exampleProteinGene
Genome Assembly: hg19
Creation Date: 2013-08-23
Views: 231
1377244800 231
Description: HBB on hg38 with single cell Heart and Merged data
Author: ashg2023
Session Name: hg38_HBB_singleCell1
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 254
1691049600 254
Description: Hemoglobin beta 3 isoforms displayed, snp155 Common turned on.
Author: ashg2023
Session Name: hg38_HBB_snp155
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 261
1691049600 261
Description:
Author: jwjiao
Session Name: E13-forebrain-H3K36me3-ChIP
Genome Assembly: mm10
Creation Date: 2017-11-06
Views: 1704
1509955200 1704
Description:
Author: ruhollah
Session Name: hg19_45Chr3_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1381
1543305600 1381
Description:
Author: ruhollah
Session Name: hg19_56Chr19_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1371
1543305600 1371
Description:
Author: isilver1
Session Name: PABPC1_CLIP_Public
Genome Assembly: mm10
Creation Date: 2015-07-01
Views: 2297
1435737600 2297
Description:
Author: xiaotiao
Session Name: 4CProject
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1311
1552636800 1311
Description:
Author: zhangjing12
Session Name: 201901-ATAC seq
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1372
1552636800 1372
Description: human chr.2 synteny to other primates
Author: marte2je
Session Name: hg38 to other primates - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 40
1726560000 40
Description: 9/17/24
Author: aehodges
Session Name: hg38 chromosome 2/Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 29
1726560000 29
Description:
Author: hujian5241
Session Name: fly_dh1_dm3
Genome Assembly: dm3
Creation Date: 2017-11-12
Views: 1488
1510473600 1488
Description:
Author: salima
Session Name: e32_tailseq_5p_3p
Genome Assembly: ce10
Creation Date: 2015-07-03
Views: 1988
1435910400 1988
Description: This session was used to answer a mailing list question about mm9.retina data. You can see how the signal data was processed to create finalized peaks.
Author: brianlee
Session Name: mm9.retina
Genome Assembly: mm9
Creation Date: 2017-11-14
Views: 1536
1510646400 1536
Description:
Author: keitermd
Session Name: Keiter, Spring 2017, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-15
Views: 1580
1484467200 1580
Description:
Author: aurbanow
Session Name: srivatsan
Genome Assembly: hg38
Creation Date: 2020-12-28
Views: 1250
1609142400 1250
Description:
Author: nicklewis
Session Name: photoreceptor sesh
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1629
1510819200 1629
Description:
Author: nicklewis
Session Name: photorecptor session
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1543
1510819200 1543
Description:
Author: nrhong
Session Name: hg38_KIAA1217
Genome Assembly: hg38
Creation Date: 2018-01-25
Views: 1560
1516867200 1560
Description:
Author: labrozam
Session Name: wt/Nrl-
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1538
1510905600 1538
Description:
Author: german.n
Session Name: zebrafish_Iso-Seq
Genome Assembly: danRer10
Creation Date: 2018-03-16
Views: 1548
1521187200 1548
Description:
Author: ruhollah
Session Name: hg19_1220_chr3_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1513
1554105600 1513
Description:
Author: Yog77
Session Name: chrMT_rCRS_NC012920
Genome Assembly: hg19
Creation Date: 2020-05-20
Views: 1169
1589961600 1169
Description:
Author: timmnat
Session Name: Figure4-Differences_in_polymorphism_frequency_and_copy number.hub_1106737_Amex_PQ.v4
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-09-13
Views: 1460
1599984000 1460
Description:
Author: [email protected]
Session Name: mm9 Loftus/Pavan Tfap2a
Genome Assembly: mm9
Creation Date: 2014-06-23
Views: 1297
1403510400 1297
Description:
Author: [email protected]
Session Name: tfap2a in Ncc, MITF hg18
Genome Assembly: hg18
Creation Date: 2014-09-30
Views: 1384
1412064000 1384
Description:
Author: grant2jm
Session Name: Grant, Fall 17, allignment example
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1491
1507536000 1491
Description:
Author: katiegal
Session Name: Lhx3-Isl1-p53
Genome Assembly: mm9
Creation Date: 2014-10-01
Views: 1164
1412150400 1164
Description:
Author: mattievaz8
Session Name: 062816_Mattie
Genome Assembly: mm10
Creation Date: 2016-06-28
Views: 1774
1467100800 1774
Description:
Author: nicklewis
Session Name: Lewis Fall17 Uba1
Genome Assembly: mm9
Creation Date: 2017-10-03
Views: 1586
1507017600 1586
Description:
Author: holtonke
Session Name: CGEMS Worm KEH test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1769
1469088000 1769
Description:
Author: alyssa
Session Name: Ayala-Ps2-ACE2-session
Genome Assembly: hg19
Creation Date: 2020-05-07
Views: 1478
1588838400 1478
Description:
Author: yierjin_2008
Session Name: MMCL.H3K27ac.SEs
Genome Assembly: hg19
Creation Date: 2017-11-10
Views: 1699
1510300800 1699
Description:
Author: ruhollah
Session Name: hg19_72Chr14_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1868
1543219200 1868
Description:
Author: ShiyiYin
Session Name: mega data with coordinations
Genome Assembly: hg19
Creation Date: 2017-02-08
Views: 1772
1486540800 1772
Description:
Author: ShiyiYin
Session Name: intron6 ehf pcr
Genome Assembly: hg19
Creation Date: 2017-01-27
Views: 1773
1485504000 1773
Description: This session highlights the "Seq-data on mm9 NS5 cells" public hub, where Juan Mateo et al. assayed crucial transcription factor binding activity forming the basis of the neural stem cell self-renewal regulatory network.
Author: chmalee
Session Name: mm9_NS5_Cell_Expression
Genome Assembly: mm9
Creation Date: 2017-11-28
Views: 2057
1511856000 2057
Description:
Author: grant2jm
Session Name: Grant, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1463
1506931200 1463
Description:
Author: isilver1
Session Name: NAD
Genome Assembly: mm10
Creation Date: 2015-03-09
Views: 1838
1425888000 1838
Description:
Author: ruhollah
Session Name: 1_50_outliers_hg19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1685
1543219200 1685
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq BCL2
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1287
1547625600 1287
Description:
Author: mspeir
Session Name: hg19_wobble
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 2346
1466150400 2346
Description:
Author: [email protected]
Session Name: example1
Genome Assembly: hg19
Creation Date: 2017-11-13
Views: 1825
1510560000 1825
Description:
Author: puertoRico2019
Session Name: DQP
Genome Assembly: hg19
Creation Date: 2019-04-12
Views: 1253
1555056000 1253
Description:
Author: mziegler
Session Name: encode_Accessibility+TAD
Genome Assembly: hg19
Creation Date: 2018-09-11
Views: 1435
1536652800 1435
Description:
Author: cath
Session Name: v338test
Genome Assembly: hg38
Creation Date: 2016-09-13
Views: 1691
1473753600 1691
Description:
Author: josoga2
Session Name: joseph_omix_hw
Genome Assembly: mm10
Creation Date: 2020-05-19
Views: 1165
1589875200 1165
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Custom Track
Genome Assembly: mm9
Creation Date: 2017-10-17
Views: 1515
1508227200 1515
Description:
Author: nicklewis
Session Name: CGEMS Yeast Test - Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1533
1508227200 1533
Description:
Author: herdaj
Session Name: Bio481 Human Custom Herd
Genome Assembly: hg38
Creation Date: 2017-10-17
Views: 1805
1508227200 1805
Description:
Author: erick.gabriel
Session Name: MYBPC1 alleles
Genome Assembly: hg19
Creation Date: 2018-09-07
Views: 1460
1536307200 1460
Description: This example session shows some selected cell lines displayed with DNaseI tracks available for the mm9 mouse assembly from the ENCODE project. You can click the grey bars at the far left to go to the track descriptions, and select even more cell types. This session is the result of a user requesting where to find known areas/regions of chromatin in the mouse genome, especially condensed regions of DNA. By entering the user's coordinates of interest the researcher could investigate data indicating hypersensitive DNase regions.
Author: brianlee
Session Name: DNase in mm9 Example
Genome Assembly: mm9
Creation Date: 2013-07-30
Views: 242
1375171200 242
Description:
Author: ruhollah
Session Name: hg19_209Chr7_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1391
1547452800 1391
Description:
Author: marzoldr
Session Name: Marzolf, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-17
Views: 1453
1516176000 1453
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. In this display, a highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancer
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1287
1553846400 1287
Description:
Author: ferrerjm
Session Name: Ferrer, FALL17, yeast custom track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 2100
1508227200 2100
Description: This session displays a region of the LHX6 gene that highlights a selection of the new tracks added in the previous year for the hg38/GRCh38 human assembly. The tracks shown in this display (from top to bottom) include GENCODE Genes V22, transcription levels assayed across 9 ENCODE cell lines, DNase hypersensitive regions based on data from 95 ENCODE cell lines, genome-wide conservation scores calculated using phastCons, a multiple genome alignment created using Lastz and Multiz, and pathogenic CNVs from the ClinGen database. Adapted from Figure 1 in Speir, et al. The UCSC Genome Browser database: 2016 update. Nucleic Acids Res. 2016 Jan 4;44(D1):D717-25: http://nar.oxfordjournals.org/content/44/D1/D717.full
Author: mspeir
Session Name: hg38_NAR_2016_Fig1
Genome Assembly: hg38
Creation Date: 2015-08-11
Views: 1923
1439280000 1923
Description:
Author: ruhollah
Session Name: hg19_1_chr15
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1492
1543219200 1492
Description:
Author: ruhollah
Session Name: hg19_4_chr3
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1421
1543219200 1421
Description:
Author: ruhollah
Session Name: hg19_3_chr14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1370
1543219200 1370
Description:
Author: ruhollah
Session Name: hg19_22Chr19_nmt32
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1500
1543219200 1500
Description:
Author: ruhollah
Session Name: hg19_25Chr5_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1353
1543219200 1353
Description:
Author: ruhollah
Session Name: hg19_69Chr1_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1386
1543219200 1386
Description:
Author: ruhollah
Session Name: hg19_17Chr3_nmt26
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1373
1543219200 1373
Description:
Author: Atma
Session Name: hervh-MYO16
Genome Assembly: hg38
Creation Date: 2019-01-22
Views: 1706
1548144000 1706
Description: This browsing started on hg38, and then the region was lifted to hg19, and then the TFBS track turned on to show how some histone activity is related to TFBS that aren't seen on hg38 because the track isn't available there.
Author: brianlee
Session Name: hg19_MTOR
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1390
1548144000 1390
Description:
Author: ruhollah
Session Name: hg19_47Chr14_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1375
1543219200 1375
Description:
Author: ruhollah
Session Name: hg19_55Chr21_nmt19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1345
1543219200 1345
Description:
Author: ruhollah
Session Name: hg19_46ChrX_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1915
1543219200 1915
Description:
Author: ruhollah
Session Name: hg19_31Chr22_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1359
1543219200 1359
Description:
Author: ruhollah
Session Name: hg19_37Chr1_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1485
1543219200 1485
Screenshot not available
Click Here to view
Description:
Author: ruhollah
Session Name: hg19_18Chr17_21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1421
1543219200 1421
Description:
Author: ruhollah
Session Name: hg19_16Chr5_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1707
1543219200 1707
Description:
Author: ruhollah
Session Name: hg19_12Chr3_nmt22
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1454
1543219200 1454
Description:
Author: ruhollah
Session Name: hg19_95Chr16_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1358
1543219200 1358
Description:
Author: kinerettaler
Session Name: danRer11_plod3+-100,000
Genome Assembly: danRer11
Creation Date: 2018-12-25
Views: 1318
1545724800 1318
Description:
Author: ruhollah
Session Name: hg19_26Chr17_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1344
1543219200 1344
Description:
Author: xiaotiao
Session Name: txiao
Genome Assembly: hg19
Creation Date: 2019-03-13
Views: 1398
1552464000 1398
Description:
Author: ruhollah
Session Name: hg19_70Chr6_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1538
1543219200 1538
Description:
Author: ldistefano
Session Name: dm6_LDiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1358
1552377600 1358
Description:
Author: marylaws
Session Name: hg18 Mol Biol Cell 2013 Grant GD
Genome Assembly: hg18
Creation Date: 2017-11-06
Views: 1773
1509955200 1773
Description: Acinetobacter baumannii ATCC 17978 UN
Author: Ab17978Cook
Session Name: GCF_019356215.1
Genome Assembly: hub_3861787_GCF_019356215.1
Creation Date: 2023-01-12
Views: 317
1673510400 317
Description:
Author: ruhollah
Session Name: hg19_75Chr7_nmt16
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1387
1543219200 1387
Description:
Author: ruhollah
Session Name: hg19_40Chr22_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1407
1543305600 1407
Description:
Author: ruhollah
Session Name: hg19_49Chr3_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1361
1543305600 1361
Description:
Author: ruhollah
Session Name: hg19_58Chr1_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1373
1543305600 1373
Description:
Author: ruhollah
Session Name: hg19_89Chr5_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1435
1543305600 1435
Description:
Author: kazuhidew
Session Name: hg38_NAR_submission
Genome Assembly: hg38
Creation Date: 2018-11-28
Views: 1493
1543392000 1493